ID: 1181430130

View in Genome Browser
Species Human (GRCh38)
Location 22:22875060-22875082
Sequence ACAAAAGACACCCCTAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181430130 Original CRISPR ACAAAAGACACCCCTAGACA GGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
902075670 1:13782880-13782902 CCAAAAAACACCCGTAGGCAAGG - Intronic
906245431 1:44270171-44270193 ACAAAAGAAACCCTGGGACAAGG + Intronic
908141876 1:61193373-61193395 ACCTAAGACACCTCTATACATGG - Intronic
909232235 1:73105579-73105601 ACAACAGCCTCCCCCAGACATGG + Intergenic
909953694 1:81751453-81751475 ACAAAAGAGAAACCTAAACAAGG + Intronic
911235120 1:95404168-95404190 ACAGAAGCCACCCCAACACATGG - Intergenic
911256458 1:95638814-95638836 ACACCAGTCATCCCTAGACATGG - Intergenic
912495307 1:110087965-110087987 ACAGAAGACACCCTGGGACAGGG - Intergenic
912958154 1:114170692-114170714 ACAAAAGAAACCCCAGGGCAGGG - Intergenic
914974711 1:152350863-152350885 ACAGGAGATACCACTAGACATGG - Exonic
914974773 1:152351313-152351335 ACAGGAGATACCACTAGACATGG - Exonic
914974834 1:152351763-152351785 ACAGCAGATACCACTAGACATGG - Exonic
917174877 1:172222673-172222695 ACAAAACAAACCCCTAAATATGG - Intronic
1063559932 10:7116407-7116429 TGGAAAGACACCCCTAGATAGGG + Intergenic
1064521914 10:16211360-16211382 ATAAAATATACCCCTAGCCAGGG - Intergenic
1064946890 10:20800605-20800627 AGAAAATACACTCCTAGAAAAGG - Intronic
1065223423 10:23518950-23518972 ACAATGGAGACCACTAGACAGGG - Intergenic
1065393312 10:25207158-25207180 GCAAAACACAACCCTAGAAATGG + Intronic
1071309663 10:84330501-84330523 ACAAAAGAAACCCCAAAACCTGG - Intronic
1071419582 10:85478565-85478587 ACATAAGACAAACCTAGAAATGG - Intergenic
1071449727 10:85782895-85782917 ATAAAAGACACACATTGACATGG + Intronic
1075647340 10:124105068-124105090 ACAGAAGCCAGCCCTACACATGG - Intergenic
1076457709 10:130612926-130612948 ACAAAAGAGACTTCAAGACATGG - Intergenic
1079794566 11:24784041-24784063 ATTAAATACACCCCTAGACACGG + Intronic
1081108093 11:39098042-39098064 ACAAAAGACATGCATAGCCATGG - Intergenic
1081475131 11:43422147-43422169 CAAAAAGACACTCCTAGAAAGGG + Intronic
1088255607 11:107900713-107900735 AGAAAAGACAACAGTAGACAAGG + Intronic
1091078686 11:132645100-132645122 TCAAAAATCACCCCTAAACAAGG - Intronic
1091695282 12:2624119-2624141 ACAAAACAAACCCCCAAACAAGG - Intronic
1094071582 12:26420821-26420843 ACAATAAACACCCCTAAAAATGG + Intronic
1094529467 12:31260367-31260389 ACAAAAGGCACCGTTTGACAAGG + Intergenic
1095633664 12:44406590-44406612 AGAAAAGACACCCAAAGACCGGG + Intergenic
1104071023 12:125345427-125345449 ACAAAAAACATTCCTGGACATGG - Intronic
1104699881 12:130894611-130894633 ACAGAAGACACCTCTTCACAGGG - Intergenic
1104919413 12:132282917-132282939 AGAAAAGCCACCCCTTGATATGG + Intronic
1107958258 13:45538388-45538410 ACACAAGTCATCCCTAGCCAGGG - Intronic
1108674300 13:52723049-52723071 ACAAAGGACTCCACAAGACAGGG - Intronic
1108716881 13:53089004-53089026 ATAAAATACTCACCTAGACAAGG + Intergenic
1112729220 13:102341113-102341135 AAAAAAGACTCCCCTAGCCTGGG + Intronic
1113373325 13:109741921-109741943 CCACCAGACACCCCTAGTCAGGG + Intergenic
1124191962 15:27587357-27587379 ATAAAAGAGACCTCAAGACAAGG - Intergenic
1125161857 15:36653483-36653505 ACAAAACAAAACCCCAGACATGG - Intronic
1125464666 15:39938975-39938997 ACAAATGAAAACCCTTGACAAGG - Intronic
1126367549 15:47911434-47911456 ACTAAAGACACCCCGCTACAGGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127887075 15:63211007-63211029 CCAAAAGATACCACTACACAAGG + Intronic
1127907386 15:63386028-63386050 CCAAATGACATGCCTAGACAGGG + Intergenic
1131075249 15:89491284-89491306 AAAAGAGACACCCCCAGACAGGG - Intronic
1131389046 15:92032443-92032465 ACATAACACAGCCCTAGACTGGG - Intronic
1143562575 17:7704577-7704599 ACAAAAGAGACCCCAAGAGTGGG + Intergenic
1147399564 17:40172076-40172098 ACAAAAAACACCACCACACATGG - Exonic
1149944341 17:60905613-60905635 ACAAATGACACCGCTTCACAAGG - Intronic
1157112119 18:44831036-44831058 AGAAAAGACAGCTCTATACAAGG - Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
925226903 2:2191160-2191182 CCAGAAGCCACCCCTAGGCATGG + Intronic
926369775 2:12168130-12168152 ACAAAGGTCACACCTAGCCAAGG + Intergenic
927289753 2:21393843-21393865 ACAAAAGAGTACCATAGACATGG + Intergenic
927441828 2:23124227-23124249 ACAAAACACTCCACTACACATGG - Intergenic
928115159 2:28540860-28540882 ACAGAAGAGACCCCAAGAGAGGG + Intronic
929245567 2:39698615-39698637 ACCAAAGACACCACAAGAAAAGG - Intronic
929455552 2:42062300-42062322 CCAAAGGACACCACCAGACAGGG + Intergenic
930440947 2:51404779-51404801 TCAAAAGACACACCTAATCAAGG - Intergenic
931009431 2:57891627-57891649 ACAAAGGACACCGCTAGAATAGG + Intergenic
931561808 2:63569946-63569968 ACAAAAGACAGCTCAAGAAAAGG + Intronic
931675295 2:64688848-64688870 ACAAAGAAAACCCCTGGACATGG + Intronic
934848130 2:97676461-97676483 AAAAAAGACACCCCTTGGCCGGG + Intergenic
940704424 2:157086079-157086101 ACAAAAGCCTCCCCCACACAAGG + Intergenic
943938988 2:193965525-193965547 ACAAAAGACACCTCTTTACAGGG - Intergenic
944411969 2:199455527-199455549 ACAACAGACACTCCGAGGCAAGG + Intronic
944846036 2:203668664-203668686 ACAAGAAACACACCTAAACATGG - Intergenic
945915593 2:215700959-215700981 ACAGAAGACTCCACTAGAAATGG + Intergenic
946266529 2:218547598-218547620 AAAAAAGACACACACAGACATGG + Intronic
946741105 2:222802598-222802620 AAAAATGAAACCCCCAGACATGG + Intergenic
1169451587 20:5716510-5716532 AAAAAAAAGACCCTTAGACAAGG - Intergenic
1170461718 20:16583293-16583315 ACAGAAAACACACCTAAACAAGG - Intergenic
1172968484 20:38856292-38856314 ACAGAAGACAGCCCCAGACCTGG + Intronic
1174839935 20:53892331-53892353 GCAAAAGAGAACCCAAGACATGG + Intergenic
1175475324 20:59269195-59269217 TCAAGAGAGACCCCTAGACATGG + Intergenic
1178361180 21:31949643-31949665 ACAAAAGACAGACTAAGACAGGG - Intronic
1178473373 21:32915179-32915201 ACACAAGAAACCACTAGAAAAGG + Intergenic
1179347055 21:40568429-40568451 ACAAAAAACACCCTAAGACCTGG - Intronic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
1183062598 22:35345335-35345357 ACAAAAGACACGCCAAGCCCAGG - Intronic
950697800 3:14716927-14716949 ACACAACACACCCCTAGACTGGG - Intronic
952018783 3:28991775-28991797 ACAAAATACACCTCAAGACGTGG - Intergenic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
953953668 3:47213446-47213468 ACAAAAAAAACCCTTAGACTAGG + Intergenic
954624952 3:52017337-52017359 ACAAAACACAACCATAGAGACGG - Intergenic
954835930 3:53467919-53467941 ACAAAAGAAAACCCAAGACCAGG - Intergenic
955628496 3:60946764-60946786 AAAACAGACACCCCTGGAGAGGG + Intronic
956020886 3:64932063-64932085 TCAAAACACACCCCGAGAAAAGG + Intergenic
958072283 3:88629804-88629826 TCAAAAGATACCCTTAAACAGGG + Intergenic
959589573 3:108063075-108063097 ACAAAATACTACCATAGACAGGG + Intronic
961212411 3:125135945-125135967 ACAAAAGTCAACCCTAGAAGTGG - Intronic
961516865 3:127443576-127443598 CCCAAAGCCAGCCCTAGACAAGG + Intergenic
961700589 3:128741672-128741694 ACAAAAGACACAGCCAGGCATGG - Intronic
963077807 3:141364030-141364052 AGAAATGACAACCATAGACAGGG + Intronic
963413451 3:144962106-144962128 ACAAAAAACAGCCCAAGACTGGG - Intergenic
966863462 3:184243274-184243296 TCACAAGAGACCCCGAGACAGGG - Intronic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
971809877 4:31410812-31410834 ACAAAATACACTCCTACACATGG - Intergenic
975995595 4:80310189-80310211 ACAAAAGACTCTGCTAGAGATGG - Intronic
977804128 4:101276252-101276274 ACAAAAAACACCTTTAGAGAAGG + Intronic
980661755 4:135869270-135869292 ACAAAATTCACCACTTGACAAGG + Intergenic
980944627 4:139307254-139307276 ACAAAAAACAAACCTACACATGG - Intronic
981685856 4:147453768-147453790 CCAAAAGATATCCATAGACAGGG - Intergenic
982761487 4:159289652-159289674 GAAAAAGACACACCTAGAGAGGG + Intronic
983095569 4:163557473-163557495 AAAAAACACACCCCTTGGCATGG - Intronic
984738458 4:183134864-183134886 TCAAAAGACACATCTAAACAAGG - Intronic
985952544 5:3234672-3234694 ACAAAACACACATCCAGACATGG - Intergenic
990967827 5:61468814-61468836 CCAAAATACACCACTATACAAGG + Intronic
991521942 5:67509759-67509781 ACAAAAGAGAACAATAGACATGG + Intergenic
996227248 5:121015051-121015073 CCAAAAGACACCCAGAGTCAGGG - Intergenic
996641808 5:125763215-125763237 ACAATAGACACTATTAGACAAGG + Intergenic
999192213 5:149756822-149756844 ACATACCACACCCCTAGTCAAGG - Intronic
999625887 5:153519700-153519722 AGGAAAGACAGTCCTAGACAAGG + Intronic
1000973832 5:167743087-167743109 ACAACATACACACCTACACATGG + Intronic
1002091471 5:176809300-176809322 ACAAAAGACAGACCGAGAGAGGG + Intergenic
1008359426 6:50598043-50598065 AGAAAAAAGACCCCTGGACATGG + Intergenic
1010628497 6:78168410-78168432 CCAACAGACACCACCAGACATGG - Intergenic
1011411563 6:87071703-87071725 TCAAAAAACATCCCAAGACAGGG - Intergenic
1014853813 6:126374491-126374513 AGAAAAGACAGGCATAGACATGG + Intergenic
1016168656 6:140979842-140979864 ACAAAAGACAGAGCTAGTCACGG - Intergenic
1017778019 6:157694780-157694802 ACAGAAGACAACTATAGACATGG + Intergenic
1022336019 7:29422933-29422955 ACGAAGCACACCCCTAAACATGG - Intronic
1023582425 7:41696910-41696932 ACAAATGACACACCAAGAAATGG - Intronic
1025139511 7:56450396-56450418 ACAAAAAACACCCCAAGGCTGGG + Intergenic
1028545695 7:91997273-91997295 ACAAAGGACACCACAAAACAGGG + Intronic
1028817461 7:95163704-95163726 ACAAAAAAAACCCCTGCACATGG - Intronic
1030767358 7:113427543-113427565 TCAAAAGACACCCTTAAAGAGGG + Intergenic
1032644601 7:133808725-133808747 ATAAAATCCACCCCCAGACATGG - Intronic
1034541750 7:151762977-151762999 ACAAAAGCCAGCACTAGAGATGG + Intronic
1035973899 8:4285419-4285441 TCATAAGAAACACCTAGACAAGG + Intronic
1036982438 8:13485048-13485070 ACAATAAAAATCCCTAGACAAGG + Intronic
1038248287 8:25879533-25879555 TTCAAAGACACCCCTGGACATGG - Intronic
1039969050 8:42306176-42306198 ACAAAAGAATGCCCTCGACACGG - Intronic
1050002726 9:1095781-1095803 ACTAGAGACAGCTCTAGACATGG - Intergenic
1051124841 9:13792121-13792143 ACAAAAGGCAGCCCCAGTCAGGG + Intergenic
1051605719 9:18916278-18916300 ACCAAAGACAACACTAGACTTGG - Intergenic
1051669276 9:19493989-19494011 TCAATAGACACCCCTTGACTTGG + Intergenic
1058894713 9:109389072-109389094 CCAATAGACACCCCTAGTGACGG - Intronic
1062060261 9:134491658-134491680 ATAAAAGACAGCCCTGGTCATGG - Intergenic
1188864293 X:35295503-35295525 ACAAAAGACCCCAATAGCCAAGG - Intergenic
1189887184 X:45559583-45559605 ACGAAAGACACCTCTTCACAGGG - Intergenic
1195210197 X:102646954-102646976 TCAAAAGACACCCCAAAATATGG - Intergenic
1197923413 X:131620452-131620474 ACAAAAGACACTTCTTGCCATGG - Intergenic
1198506082 X:137302678-137302700 ACAACAGAAACCCCCAGAAAGGG - Intergenic
1199365568 X:146978100-146978122 ACAAAGTAGACTCCTAGACAAGG + Intergenic
1199585339 X:149409603-149409625 GAAAAAGATACTCCTAGACATGG - Intergenic
1199838139 X:151614278-151614300 ATAAAAGAAACCCCTAGGCTGGG - Intronic