ID: 1181433715

View in Genome Browser
Species Human (GRCh38)
Location 22:22898237-22898259
Sequence CCTCCCAAAACAAGAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181433710_1181433715 0 Left 1181433710 22:22898214-22898236 CCCACGGTTGGAATACAGCCACA No data
Right 1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG No data
1181433711_1181433715 -1 Left 1181433711 22:22898215-22898237 CCACGGTTGGAATACAGCCACAC No data
Right 1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG No data
1181433709_1181433715 4 Left 1181433709 22:22898210-22898232 CCTTCCCACGGTTGGAATACAGC No data
Right 1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG No data
1181433708_1181433715 11 Left 1181433708 22:22898203-22898225 CCGGGGACCTTCCCACGGTTGGA No data
Right 1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181433715 Original CRISPR CCTCCCAAAACAAGAACCCA GGG Intergenic
No off target data available for this crispr