ID: 1181434540

View in Genome Browser
Species Human (GRCh38)
Location 22:22902700-22902722
Sequence ACAGGGAGTCTAAGTTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434540_1181434543 -2 Left 1181434540 22:22902700-22902722 CCACGCAAACTTAGACTCCCTGT No data
Right 1181434543 22:22902721-22902743 GTCTCTGCCTCCAGCACATCAGG No data
1181434540_1181434547 30 Left 1181434540 22:22902700-22902722 CCACGCAAACTTAGACTCCCTGT No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434540_1181434545 5 Left 1181434540 22:22902700-22902722 CCACGCAAACTTAGACTCCCTGT No data
Right 1181434545 22:22902728-22902750 CCTCCAGCACATCAGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434540 Original CRISPR ACAGGGAGTCTAAGTTTGCG TGG (reversed) Intergenic