ID: 1181434541

View in Genome Browser
Species Human (GRCh38)
Location 22:22902717-22902739
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434541_1181434547 13 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434541_1181434548 14 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434548 22:22902754-22902776 CTGAGTTCACCAGAGCTGCTGGG No data
1181434541_1181434551 27 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434551 22:22902767-22902789 AGCTGCTGGGTGGTCCCGACAGG No data
1181434541_1181434549 17 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434541 Original CRISPR ATGTGCTGGAGGCAGAGACA GGG (reversed) Intergenic