ID: 1181434542

View in Genome Browser
Species Human (GRCh38)
Location 22:22902718-22902740
Sequence GATGTGCTGGAGGCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434542_1181434547 12 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434542_1181434551 26 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434551 22:22902767-22902789 AGCTGCTGGGTGGTCCCGACAGG No data
1181434542_1181434549 16 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data
1181434542_1181434548 13 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434548 22:22902754-22902776 CTGAGTTCACCAGAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434542 Original CRISPR GATGTGCTGGAGGCAGAGAC AGG (reversed) Intergenic