ID: 1181434546

View in Genome Browser
Species Human (GRCh38)
Location 22:22902731-22902753
Sequence CTGCCACATTCCTGATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434546_1181434549 3 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data
1181434546_1181434547 -1 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434546_1181434552 18 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434552 22:22902772-22902794 CTGGGTGGTCCCGACAGGCCAGG No data
1181434546_1181434548 0 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434548 22:22902754-22902776 CTGAGTTCACCAGAGCTGCTGGG No data
1181434546_1181434551 13 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434551 22:22902767-22902789 AGCTGCTGGGTGGTCCCGACAGG No data
1181434546_1181434553 19 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434553 22:22902773-22902795 TGGGTGGTCCCGACAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434546 Original CRISPR CTGCCACATTCCTGATGTGC TGG (reversed) Intergenic