ID: 1181434547

View in Genome Browser
Species Human (GRCh38)
Location 22:22902753-22902775
Sequence GCTGAGTTCACCAGAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434542_1181434547 12 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434544_1181434547 2 Left 1181434544 22:22902728-22902750 CCTCCAGCACATCAGGAATGTGG No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434540_1181434547 30 Left 1181434540 22:22902700-22902722 CCACGCAAACTTAGACTCCCTGT No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434541_1181434547 13 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data
1181434546_1181434547 -1 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434547 Original CRISPR GCTGAGTTCACCAGAGCTGC TGG Intergenic