ID: 1181434549

View in Genome Browser
Species Human (GRCh38)
Location 22:22902757-22902779
Sequence AGTTCACCAGAGCTGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434546_1181434549 3 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data
1181434542_1181434549 16 Left 1181434542 22:22902718-22902740 CCTGTCTCTGCCTCCAGCACATC No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data
1181434544_1181434549 6 Left 1181434544 22:22902728-22902750 CCTCCAGCACATCAGGAATGTGG No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data
1181434541_1181434549 17 Left 1181434541 22:22902717-22902739 CCCTGTCTCTGCCTCCAGCACAT No data
Right 1181434549 22:22902757-22902779 AGTTCACCAGAGCTGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434549 Original CRISPR AGTTCACCAGAGCTGCTGGG TGG Intergenic