ID: 1181434552 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:22902772-22902794 |
| Sequence | CTGGGTGGTCCCGACAGGCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1181434544_1181434552 | 21 | Left | 1181434544 | 22:22902728-22902750 | CCTCCAGCACATCAGGAATGTGG | No data | ||
| Right | 1181434552 | 22:22902772-22902794 | CTGGGTGGTCCCGACAGGCCAGG | No data | ||||
| 1181434546_1181434552 | 18 | Left | 1181434546 | 22:22902731-22902753 | CCAGCACATCAGGAATGTGGCAG | No data | ||
| Right | 1181434552 | 22:22902772-22902794 | CTGGGTGGTCCCGACAGGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1181434552 | Original CRISPR | CTGGGTGGTCCCGACAGGCC AGG | Intergenic | ||