ID: 1181434552 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:22902772-22902794 |
Sequence | CTGGGTGGTCCCGACAGGCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181434544_1181434552 | 21 | Left | 1181434544 | 22:22902728-22902750 | CCTCCAGCACATCAGGAATGTGG | No data | ||
Right | 1181434552 | 22:22902772-22902794 | CTGGGTGGTCCCGACAGGCCAGG | No data | ||||
1181434546_1181434552 | 18 | Left | 1181434546 | 22:22902731-22902753 | CCAGCACATCAGGAATGTGGCAG | No data | ||
Right | 1181434552 | 22:22902772-22902794 | CTGGGTGGTCCCGACAGGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181434552 | Original CRISPR | CTGGGTGGTCCCGACAGGCC AGG | Intergenic | ||