ID: 1181434553

View in Genome Browser
Species Human (GRCh38)
Location 22:22902773-22902795
Sequence TGGGTGGTCCCGACAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181434546_1181434553 19 Left 1181434546 22:22902731-22902753 CCAGCACATCAGGAATGTGGCAG No data
Right 1181434553 22:22902773-22902795 TGGGTGGTCCCGACAGGCCAGGG No data
1181434544_1181434553 22 Left 1181434544 22:22902728-22902750 CCTCCAGCACATCAGGAATGTGG No data
Right 1181434553 22:22902773-22902795 TGGGTGGTCCCGACAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181434553 Original CRISPR TGGGTGGTCCCGACAGGCCA GGG Intergenic