ID: 1181437080

View in Genome Browser
Species Human (GRCh38)
Location 22:22917321-22917343
Sequence TGGAGTGTCACCGGCACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437080_1181437092 14 Left 1181437080 22:22917321-22917343 CCCCCCGTGCCGGTGACACTCCA No data
Right 1181437092 22:22917358-22917380 TGGGTCACCCGTGCATGTAGGGG No data
1181437080_1181437088 -5 Left 1181437080 22:22917321-22917343 CCCCCCGTGCCGGTGACACTCCA No data
Right 1181437088 22:22917339-22917361 CTCCAGAGCACAGGCTGTGTGGG No data
1181437080_1181437091 13 Left 1181437080 22:22917321-22917343 CCCCCCGTGCCGGTGACACTCCA No data
Right 1181437091 22:22917357-22917379 GTGGGTCACCCGTGCATGTAGGG No data
1181437080_1181437090 12 Left 1181437080 22:22917321-22917343 CCCCCCGTGCCGGTGACACTCCA No data
Right 1181437090 22:22917356-22917378 TGTGGGTCACCCGTGCATGTAGG No data
1181437080_1181437087 -6 Left 1181437080 22:22917321-22917343 CCCCCCGTGCCGGTGACACTCCA No data
Right 1181437087 22:22917338-22917360 ACTCCAGAGCACAGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437080 Original CRISPR TGGAGTGTCACCGGCACGGG GGG (reversed) Intergenic
No off target data available for this crispr