ID: 1181437275

View in Genome Browser
Species Human (GRCh38)
Location 22:22918184-22918206
Sequence CTCACCGAGGACGGTCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437275_1181437284 6 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437284 22:22918213-22918235 TTTCTATTCTTTTGGGTCTAGGG No data
1181437275_1181437283 5 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data
1181437275_1181437285 16 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437285 22:22918223-22918245 TTTGGGTCTAGGGTGAGATCTGG No data
1181437275_1181437287 18 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437275_1181437278 -2 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437278 22:22918205-22918227 AGTCCCCTTTTCTATTCTTTTGG No data
1181437275_1181437286 17 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437286 22:22918224-22918246 TTGGGTCTAGGGTGAGATCTGGG No data
1181437275_1181437279 -1 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437279 22:22918206-22918228 GTCCCCTTTTCTATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437275 Original CRISPR CTCACCGAGGACGGTCACCT TGG (reversed) Intergenic