ID: 1181437276

View in Genome Browser
Species Human (GRCh38)
Location 22:22918193-22918215
Sequence AAAAGGGGACTCACCGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437276_1181437279 -10 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437279 22:22918206-22918228 GTCCCCTTTTCTATTCTTTTGGG No data
1181437276_1181437285 7 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437285 22:22918223-22918245 TTTGGGTCTAGGGTGAGATCTGG No data
1181437276_1181437287 9 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437276_1181437284 -3 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437284 22:22918213-22918235 TTTCTATTCTTTTGGGTCTAGGG No data
1181437276_1181437286 8 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437286 22:22918224-22918246 TTGGGTCTAGGGTGAGATCTGGG No data
1181437276_1181437283 -4 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437276 Original CRISPR AAAAGGGGACTCACCGAGGA CGG (reversed) Intergenic