ID: 1181437277

View in Genome Browser
Species Human (GRCh38)
Location 22:22918197-22918219
Sequence ATAGAAAAGGGGACTCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437277_1181437286 4 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437286 22:22918224-22918246 TTGGGTCTAGGGTGAGATCTGGG No data
1181437277_1181437284 -7 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437284 22:22918213-22918235 TTTCTATTCTTTTGGGTCTAGGG No data
1181437277_1181437283 -8 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data
1181437277_1181437285 3 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437285 22:22918223-22918245 TTTGGGTCTAGGGTGAGATCTGG No data
1181437277_1181437287 5 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437277 Original CRISPR ATAGAAAAGGGGACTCACCG AGG (reversed) Intergenic
No off target data available for this crispr