ID: 1181437279

View in Genome Browser
Species Human (GRCh38)
Location 22:22918206-22918228
Sequence GTCCCCTTTTCTATTCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437276_1181437279 -10 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437279 22:22918206-22918228 GTCCCCTTTTCTATTCTTTTGGG No data
1181437275_1181437279 -1 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437279 22:22918206-22918228 GTCCCCTTTTCTATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437279 Original CRISPR GTCCCCTTTTCTATTCTTTT GGG Intergenic
No off target data available for this crispr