ID: 1181437281

View in Genome Browser
Species Human (GRCh38)
Location 22:22918209-22918231
Sequence AGACCCAAAAGAATAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437281_1181437287 -7 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437281_1181437288 24 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437288 22:22918256-22918278 CTGTCCTTTCTGTTCTCTCTAGG No data
1181437281_1181437289 25 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437289 22:22918257-22918279 TGTCCTTTCTGTTCTCTCTAGGG No data
1181437281_1181437286 -8 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437286 22:22918224-22918246 TTGGGTCTAGGGTGAGATCTGGG No data
1181437281_1181437285 -9 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437285 22:22918223-22918245 TTTGGGTCTAGGGTGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437281 Original CRISPR AGACCCAAAAGAATAGAAAA GGG (reversed) Intergenic