ID: 1181437282

View in Genome Browser
Species Human (GRCh38)
Location 22:22918210-22918232
Sequence TAGACCCAAAAGAATAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437282_1181437289 24 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437289 22:22918257-22918279 TGTCCTTTCTGTTCTCTCTAGGG No data
1181437282_1181437285 -10 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437285 22:22918223-22918245 TTTGGGTCTAGGGTGAGATCTGG No data
1181437282_1181437288 23 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437288 22:22918256-22918278 CTGTCCTTTCTGTTCTCTCTAGG No data
1181437282_1181437287 -8 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437282_1181437286 -9 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437286 22:22918224-22918246 TTGGGTCTAGGGTGAGATCTGGG No data
1181437282_1181437291 30 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437291 22:22918263-22918285 TTCTGTTCTCTCTAGGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437282 Original CRISPR TAGACCCAAAAGAATAGAAA AGG (reversed) Intergenic
No off target data available for this crispr