ID: 1181437283

View in Genome Browser
Species Human (GRCh38)
Location 22:22918212-22918234
Sequence TTTTCTATTCTTTTGGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437277_1181437283 -8 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data
1181437275_1181437283 5 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data
1181437276_1181437283 -4 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437283 22:22918212-22918234 TTTTCTATTCTTTTGGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437283 Original CRISPR TTTTCTATTCTTTTGGGTCT AGG Intergenic
No off target data available for this crispr