ID: 1181437287

View in Genome Browser
Species Human (GRCh38)
Location 22:22918225-22918247
Sequence TGGGTCTAGGGTGAGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437282_1181437287 -8 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437276_1181437287 9 Left 1181437276 22:22918193-22918215 CCGTCCTCGGTGAGTCCCCTTTT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437277_1181437287 5 Left 1181437277 22:22918197-22918219 CCTCGGTGAGTCCCCTTTTCTAT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437281_1181437287 -7 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437280_1181437287 -6 Left 1181437280 22:22918208-22918230 CCCCTTTTCTATTCTTTTGGGTC No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data
1181437275_1181437287 18 Left 1181437275 22:22918184-22918206 CCAAGGTGACCGTCCTCGGTGAG No data
Right 1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437287 Original CRISPR TGGGTCTAGGGTGAGATCTG GGG Intergenic
No off target data available for this crispr