ID: 1181437289

View in Genome Browser
Species Human (GRCh38)
Location 22:22918257-22918279
Sequence TGTCCTTTCTGTTCTCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437281_1181437289 25 Left 1181437281 22:22918209-22918231 CCCTTTTCTATTCTTTTGGGTCT No data
Right 1181437289 22:22918257-22918279 TGTCCTTTCTGTTCTCTCTAGGG No data
1181437282_1181437289 24 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437289 22:22918257-22918279 TGTCCTTTCTGTTCTCTCTAGGG No data
1181437280_1181437289 26 Left 1181437280 22:22918208-22918230 CCCCTTTTCTATTCTTTTGGGTC No data
Right 1181437289 22:22918257-22918279 TGTCCTTTCTGTTCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437289 Original CRISPR TGTCCTTTCTGTTCTCTCTA GGG Intergenic
No off target data available for this crispr