ID: 1181437291

View in Genome Browser
Species Human (GRCh38)
Location 22:22918263-22918285
Sequence TTCTGTTCTCTCTAGGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181437282_1181437291 30 Left 1181437282 22:22918210-22918232 CCTTTTCTATTCTTTTGGGTCTA No data
Right 1181437291 22:22918263-22918285 TTCTGTTCTCTCTAGGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181437291 Original CRISPR TTCTGTTCTCTCTAGGGTAG AGG Intergenic
No off target data available for this crispr