ID: 1181438529

View in Genome Browser
Species Human (GRCh38)
Location 22:22924023-22924045
Sequence CTGTGAGGTTCCCTGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181438525_1181438529 -5 Left 1181438525 22:22924005-22924027 CCCTCATCAGGACTTTCTCTGTG No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438522_1181438529 15 Left 1181438522 22:22923985-22924007 CCTTCACTGGAAAACCAGGTCCC No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438517_1181438529 30 Left 1181438517 22:22923970-22923992 CCATTGGATCCCGGGCCTTCACT No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438524_1181438529 1 Left 1181438524 22:22923999-22924021 CCAGGTCCCTCATCAGGACTTTC No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438519_1181438529 21 Left 1181438519 22:22923979-22924001 CCCGGGCCTTCACTGGAAAACCA No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438526_1181438529 -6 Left 1181438526 22:22924006-22924028 CCTCATCAGGACTTTCTCTGTGA 0: 3
1: 0
2: 2
3: 19
4: 207
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data
1181438520_1181438529 20 Left 1181438520 22:22923980-22924002 CCGGGCCTTCACTGGAAAACCAG No data
Right 1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181438529 Original CRISPR CTGTGAGGTTCCCTGAGTCT GGG Intergenic
No off target data available for this crispr