ID: 1181438923

View in Genome Browser
Species Human (GRCh38)
Location 22:22925653-22925675
Sequence CACCTACTGCGCTCGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181438923_1181438931 -4 Left 1181438923 22:22925653-22925675 CCCAGCACCGAGCGCAGTAGGTG No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181438923 Original CRISPR CACCTACTGCGCTCGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr