ID: 1181438931

View in Genome Browser
Species Human (GRCh38)
Location 22:22925672-22925694
Sequence GGTGTTCGAGGGGGGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181438919_1181438931 12 Left 1181438919 22:22925637-22925659 CCCGGTCCTCTCGGGGCCCAGCA No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data
1181438920_1181438931 11 Left 1181438920 22:22925638-22925660 CCGGTCCTCTCGGGGCCCAGCAC No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data
1181438918_1181438931 13 Left 1181438918 22:22925636-22925658 CCCCGGTCCTCTCGGGGCCCAGC No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data
1181438921_1181438931 6 Left 1181438921 22:22925643-22925665 CCTCTCGGGGCCCAGCACCGAGC No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data
1181438923_1181438931 -4 Left 1181438923 22:22925653-22925675 CCCAGCACCGAGCGCAGTAGGTG No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data
1181438924_1181438931 -5 Left 1181438924 22:22925654-22925676 CCAGCACCGAGCGCAGTAGGTGT No data
Right 1181438931 22:22925672-22925694 GGTGTTCGAGGGGGGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181438931 Original CRISPR GGTGTTCGAGGGGGGCTGAG TGG Intergenic
No off target data available for this crispr