ID: 1181438951

View in Genome Browser
Species Human (GRCh38)
Location 22:22925879-22925901
Sequence ATGTGGCTAAGGAGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181438943_1181438951 16 Left 1181438943 22:22925840-22925862 CCACTCCATGTTAACAAAAGGAT No data
Right 1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG No data
1181438944_1181438951 11 Left 1181438944 22:22925845-22925867 CCATGTTAACAAAAGGATGAAGC No data
Right 1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG No data
1181438941_1181438951 19 Left 1181438941 22:22925837-22925859 CCTCCACTCCATGTTAACAAAAG No data
Right 1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181438951 Original CRISPR ATGTGGCTAAGGAGTGAGGG AGG Intergenic
No off target data available for this crispr