ID: 1181440397

View in Genome Browser
Species Human (GRCh38)
Location 22:22932597-22932619
Sequence CAGCTGCCAAGAGGACTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181440390_1181440397 14 Left 1181440390 22:22932560-22932582 CCCAGAGCCTGAGGCAGTAACGA No data
Right 1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG No data
1181440387_1181440397 23 Left 1181440387 22:22932551-22932573 CCCTGGGAGCCCAGAGCCTGAGG No data
Right 1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG No data
1181440392_1181440397 7 Left 1181440392 22:22932567-22932589 CCTGAGGCAGTAACGAAGCTCCT No data
Right 1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG No data
1181440389_1181440397 22 Left 1181440389 22:22932552-22932574 CCTGGGAGCCCAGAGCCTGAGGC No data
Right 1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG No data
1181440391_1181440397 13 Left 1181440391 22:22932561-22932583 CCAGAGCCTGAGGCAGTAACGAA No data
Right 1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181440397 Original CRISPR CAGCTGCCAAGAGGACTTCC GGG Intergenic
No off target data available for this crispr