ID: 1181441569

View in Genome Browser
Species Human (GRCh38)
Location 22:22938652-22938674
Sequence AGGTGTGACCTTAGCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181441566_1181441569 -7 Left 1181441566 22:22938636-22938658 CCCTAGCAAGCTTCTCAGGTGTG No data
Right 1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG No data
1181441564_1181441569 30 Left 1181441564 22:22938599-22938621 CCTGGAAGGACATATGTGCACGA No data
Right 1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG No data
1181441567_1181441569 -8 Left 1181441567 22:22938637-22938659 CCTAGCAAGCTTCTCAGGTGTGA No data
Right 1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181441569 Original CRISPR AGGTGTGACCTTAGCATTGG AGG Intergenic
No off target data available for this crispr