ID: 1181441704

View in Genome Browser
Species Human (GRCh38)
Location 22:22939359-22939381
Sequence GAGAACACCACCACAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181441694_1181441704 15 Left 1181441694 22:22939321-22939343 CCTGGGAACAGCATACACTGGTG No data
Right 1181441704 22:22939359-22939381 GAGAACACCACCACAGGGGCAGG No data
1181441692_1181441704 18 Left 1181441692 22:22939318-22939340 CCACCTGGGAACAGCATACACTG No data
Right 1181441704 22:22939359-22939381 GAGAACACCACCACAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181441704 Original CRISPR GAGAACACCACCACAGGGGC AGG Intergenic
No off target data available for this crispr