ID: 1181441777

View in Genome Browser
Species Human (GRCh38)
Location 22:22939822-22939844
Sequence AGTTGAGGCTACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181441766_1181441777 20 Left 1181441766 22:22939779-22939801 CCAGCGACCTCAAACTTCAGGCG No data
Right 1181441777 22:22939822-22939844 AGTTGAGGCTACAGGGACACAGG No data
1181441764_1181441777 23 Left 1181441764 22:22939776-22939798 CCACCAGCGACCTCAAACTTCAG No data
Right 1181441777 22:22939822-22939844 AGTTGAGGCTACAGGGACACAGG No data
1181441768_1181441777 13 Left 1181441768 22:22939786-22939808 CCTCAAACTTCAGGCGCAGGTGG No data
Right 1181441777 22:22939822-22939844 AGTTGAGGCTACAGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181441777 Original CRISPR AGTTGAGGCTACAGGGACAC AGG Intergenic
No off target data available for this crispr