ID: 1181442069

View in Genome Browser
Species Human (GRCh38)
Location 22:22941835-22941857
Sequence CCTTGCTGTGGGAGGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181442058_1181442069 0 Left 1181442058 22:22941812-22941834 CCTGGCTCTCCTGGGGTGGCTGC No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442059_1181442069 -9 Left 1181442059 22:22941821-22941843 CCTGGGGTGGCTGCCCTTGCTGT No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442047_1181442069 28 Left 1181442047 22:22941784-22941806 CCTTAGTTCCCAAGTCTTCAGTC No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442049_1181442069 19 Left 1181442049 22:22941793-22941815 CCAAGTCTTCAGTCCCCAGCCTG No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442055_1181442069 5 Left 1181442055 22:22941807-22941829 CCCAGCCTGGCTCTCCTGGGGTG No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442048_1181442069 20 Left 1181442048 22:22941792-22941814 CCCAAGTCTTCAGTCCCCAGCCT No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442056_1181442069 4 Left 1181442056 22:22941808-22941830 CCAGCCTGGCTCTCCTGGGGTGG No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data
1181442054_1181442069 6 Left 1181442054 22:22941806-22941828 CCCCAGCCTGGCTCTCCTGGGGT No data
Right 1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181442069 Original CRISPR CCTTGCTGTGGGAGGCTGGG GGG Intergenic
No off target data available for this crispr