ID: 1181444467

View in Genome Browser
Species Human (GRCh38)
Location 22:22958277-22958299
Sequence TCATCGCTATGGTGACATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181444467_1181444472 21 Left 1181444467 22:22958277-22958299 CCATCATGTCACCATAGCGATGA No data
Right 1181444472 22:22958321-22958343 GTGGAAAACTTCTGACTTCAAGG No data
1181444467_1181444473 25 Left 1181444467 22:22958277-22958299 CCATCATGTCACCATAGCGATGA No data
Right 1181444473 22:22958325-22958347 AAAACTTCTGACTTCAAGGATGG No data
1181444467_1181444469 -8 Left 1181444467 22:22958277-22958299 CCATCATGTCACCATAGCGATGA No data
Right 1181444469 22:22958292-22958314 AGCGATGACTCCTCTAATGATGG No data
1181444467_1181444471 2 Left 1181444467 22:22958277-22958299 CCATCATGTCACCATAGCGATGA No data
Right 1181444471 22:22958302-22958324 CCTCTAATGATGGTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181444467 Original CRISPR TCATCGCTATGGTGACATGA TGG (reversed) Intergenic