ID: 1181445893

View in Genome Browser
Species Human (GRCh38)
Location 22:22973920-22973942
Sequence AGCCATCTGGTCACTTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181445891_1181445893 -3 Left 1181445891 22:22973900-22973922 CCAAAGGCAAAGGATGAATGAGC No data
Right 1181445893 22:22973920-22973942 AGCCATCTGGTCACTTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181445893 Original CRISPR AGCCATCTGGTCACTTCCAG AGG Intergenic
No off target data available for this crispr