ID: 1181447590

View in Genome Browser
Species Human (GRCh38)
Location 22:22989967-22989989
Sequence CCTGCTTTGCAAGAGCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181447590_1181447594 -2 Left 1181447590 22:22989967-22989989 CCATACTGCTCTTGCAAAGCAGG No data
Right 1181447594 22:22989988-22990010 GGGATACCCCATAGGCAGAGAGG No data
1181447590_1181447598 9 Left 1181447590 22:22989967-22989989 CCATACTGCTCTTGCAAAGCAGG No data
Right 1181447598 22:22989999-22990021 TAGGCAGAGAGGAGCAGTTGAGG No data
1181447590_1181447593 -10 Left 1181447590 22:22989967-22989989 CCATACTGCTCTTGCAAAGCAGG No data
Right 1181447593 22:22989980-22990002 GCAAAGCAGGGATACCCCATAGG No data
1181447590_1181447599 10 Left 1181447590 22:22989967-22989989 CCATACTGCTCTTGCAAAGCAGG No data
Right 1181447599 22:22990000-22990022 AGGCAGAGAGGAGCAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181447590 Original CRISPR CCTGCTTTGCAAGAGCAGTA TGG (reversed) Intergenic
No off target data available for this crispr