ID: 1181451578

View in Genome Browser
Species Human (GRCh38)
Location 22:23026257-23026279
Sequence ATGCAAATTAATAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181451576_1181451578 15 Left 1181451576 22:23026219-23026241 CCACAAAATAAGTGATAGAATTT No data
Right 1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181451578 Original CRISPR ATGCAAATTAATAAGGAAGA AGG Intergenic
No off target data available for this crispr