ID: 1181451805

View in Genome Browser
Species Human (GRCh38)
Location 22:23027670-23027692
Sequence CAGGGTAAACAGATCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181451805_1181451811 18 Left 1181451805 22:23027670-23027692 CCATGTAAGATCTGTTTACCCTG No data
Right 1181451811 22:23027711-23027733 TCTCCCTATAAAATGCCAAGTGG 0: 5
1: 5
2: 14
3: 20
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181451805 Original CRISPR CAGGGTAAACAGATCTTACA TGG (reversed) Intergenic
No off target data available for this crispr