ID: 1181451805 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:23027670-23027692 |
Sequence | CAGGGTAAACAGATCTTACA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181451805_1181451811 | 18 | Left | 1181451805 | 22:23027670-23027692 | CCATGTAAGATCTGTTTACCCTG | No data | ||
Right | 1181451811 | 22:23027711-23027733 | TCTCCCTATAAAATGCCAAGTGG | 0: 5 1: 5 2: 14 3: 20 4: 152 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181451805 | Original CRISPR | CAGGGTAAACAGATCTTACA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |