ID: 1181453728

View in Genome Browser
Species Human (GRCh38)
Location 22:23041371-23041393
Sequence TCCATGGTTTGGAGTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181453728_1181453735 26 Left 1181453728 22:23041371-23041393 CCTCATTTACTCCAAACCATGGA No data
Right 1181453735 22:23041420-23041442 TCTAGAAGAATGAAGGATCGTGG No data
1181453728_1181453732 19 Left 1181453728 22:23041371-23041393 CCTCATTTACTCCAAACCATGGA No data
Right 1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181453728 Original CRISPR TCCATGGTTTGGAGTAAATG AGG (reversed) Intergenic
No off target data available for this crispr