ID: 1181453732

View in Genome Browser
Species Human (GRCh38)
Location 22:23041413-23041435
Sequence ATGCCCATCTAGAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181453730_1181453732 3 Left 1181453730 22:23041387-23041409 CCATGGAAAAAGAGACCTAAGAA No data
Right 1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG No data
1181453728_1181453732 19 Left 1181453728 22:23041371-23041393 CCTCATTTACTCCAAACCATGGA No data
Right 1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG No data
1181453729_1181453732 8 Left 1181453729 22:23041382-23041404 CCAAACCATGGAAAAAGAGACCT No data
Right 1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181453732 Original CRISPR ATGCCCATCTAGAAGAATGA AGG Intergenic
No off target data available for this crispr