ID: 1181455680

View in Genome Browser
Species Human (GRCh38)
Location 22:23058997-23059019
Sequence AACCCCATGCAGGTTCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181455680_1181455686 12 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455686 22:23059032-23059054 TTCCTTCCCATCACCCAGGGTGG No data
1181455680_1181455696 29 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455696 22:23059049-23059071 GGGTGGGGAAGGGACAGACCTGG No data
1181455680_1181455691 18 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455691 22:23059038-23059060 CCCATCACCCAGGGTGGGGAAGG No data
1181455680_1181455689 14 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455689 22:23059034-23059056 CCTTCCCATCACCCAGGGTGGGG No data
1181455680_1181455687 13 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455687 22:23059033-23059055 TCCTTCCCATCACCCAGGGTGGG No data
1181455680_1181455693 19 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455693 22:23059039-23059061 CCATCACCCAGGGTGGGGAAGGG No data
1181455680_1181455683 8 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455683 22:23059028-23059050 CACCTTCCTTCCCATCACCCAGG No data
1181455680_1181455684 9 Left 1181455680 22:23058997-23059019 CCACGAAGAACCTGCATGGGGTT No data
Right 1181455684 22:23059029-23059051 ACCTTCCTTCCCATCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181455680 Original CRISPR AACCCCATGCAGGTTCTTCG TGG (reversed) Intergenic
No off target data available for this crispr