ID: 1181456093

View in Genome Browser
Species Human (GRCh38)
Location 22:23061014-23061036
Sequence TCCACAGCCCCTCCTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181456093_1181456101 28 Left 1181456093 22:23061014-23061036 CCAGTAAAAGGAGGGGCTGTGGA 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1181456101 22:23061065-23061087 TGCATACCTCAAGCAGCATTAGG 0: 1
1: 0
2: 0
3: 4
4: 87
1181456093_1181456102 29 Left 1181456093 22:23061014-23061036 CCAGTAAAAGGAGGGGCTGTGGA 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1181456102 22:23061066-23061088 GCATACCTCAAGCAGCATTAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181456093 Original CRISPR TCCACAGCCCCTCCTTTTAC TGG (reversed) Intronic
900596670 1:3483164-3483186 TGCACAGACCCTCCTGTTGCAGG + Intergenic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
901176014 1:7299694-7299716 CCCACAGTCCCTGCTTGTACAGG - Intronic
901365624 1:8745678-8745700 TCCTCAGCCCCTTCTCTTCCAGG + Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904093523 1:27960805-27960827 TCCGCAGCCCCTGCCATTACAGG - Intronic
904099955 1:28017039-28017061 TCCACAGCCCATACTATTCCTGG + Intronic
904703485 1:32373256-32373278 TCCTCAGCCTCTCCTTTCACAGG + Intronic
905564023 1:38948993-38949015 TCCACAGCCCCTCCAGTGATAGG + Intergenic
907603050 1:55789145-55789167 TCCATAACCCCTACTCTTACTGG + Intergenic
910726888 1:90349269-90349291 GCCACAGCCCCTCCCATCACAGG + Intergenic
911334139 1:96560802-96560824 TCTTCAGCCCCTCCTTTCCCTGG - Intergenic
912073117 1:105839206-105839228 TCAGCAGCCCCTCCTCTCACAGG + Intergenic
917655321 1:177120114-177120136 TCCACTGCTCCTCCATTTTCTGG - Intronic
917853315 1:179082918-179082940 CTCACAGCTCCTCCTTTTCCAGG + Exonic
918755893 1:188339044-188339066 TCCACAACCCCTACTTTAACTGG + Intergenic
918805892 1:189043939-189043961 TTCACAGCCCCTCCTTCTTCAGG + Intergenic
918844713 1:189594770-189594792 ACAACAGCCCCTCCCATTACAGG + Intergenic
919522125 1:198601119-198601141 TCAGCAGCCCCTCCCATTACAGG - Intergenic
919833090 1:201555783-201555805 CCCACTGCCCCTCCCTTTTCTGG - Intergenic
920967649 1:210714484-210714506 TCCACAACCCATCCATTGACAGG - Intronic
922602804 1:226870296-226870318 TCCACATCCCCTCCTCCTCCCGG - Intronic
922874277 1:228927564-228927586 TTCTCAGCCACTCCTTTTCCTGG + Intergenic
923062124 1:230485168-230485190 TCCACAGCCTCTCCTTGTAAGGG - Intergenic
923559704 1:235029258-235029280 TGCCCAGCACCTCCTTTCACAGG - Intergenic
923654224 1:235901455-235901477 CTCACAGCCCCTCCTTCTCCTGG + Intergenic
923854514 1:237831345-237831367 TCCACAGCCTTTCCTCTTTCTGG + Intronic
1065473958 10:26113805-26113827 TCCCTTTCCCCTCCTTTTACTGG - Intronic
1066315560 10:34242488-34242510 TTAACAACCCCTCATTTTACGGG - Intronic
1069412592 10:68168652-68168674 TCCCCAGCCCCACCTATGACTGG - Intronic
1069821649 10:71232206-71232228 CCCCCAGCACCTCCTTTTCCTGG + Intronic
1070143866 10:73759761-73759783 GCCCCAGCCCCTCCTTCTTCAGG + Exonic
1071013619 10:80968066-80968088 TACAAAGGCCCTCCTTTTAGTGG - Intergenic
1071298688 10:84240921-84240943 TCCCCAGCCCCTTCTTTCCCAGG - Intronic
1071401021 10:85270858-85270880 TTCCCAGCCCCTTCTTTTGCTGG - Intergenic
1071937527 10:90548071-90548093 TCCATAACCCCTACTTTAACTGG - Intergenic
1071996294 10:91153011-91153033 TCCACAGTCCTTCCTTTTGATGG + Intergenic
1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG + Intronic
1075262581 10:120976063-120976085 TCCACATCCCTTCCGTTTCCTGG + Intergenic
1075835797 10:125451716-125451738 ACCACAGACCCTTCTGTTACTGG + Intergenic
1076210072 10:128632985-128633007 TGCAGAGTCCCTCCTTCTACTGG - Intergenic
1076803659 10:132844573-132844595 TCCTCAGGCCCTCCTGTTTCAGG - Intronic
1078201619 11:9188999-9189021 ACGGCAGCCCCTCCCTTTACAGG + Intronic
1079964326 11:26962211-26962233 TTCACAGCTCCTCACTTTACCGG + Intergenic
1081871935 11:46386964-46386986 TCCACAGCTCCTCCTGTGGCTGG - Intergenic
1083271920 11:61577031-61577053 CCCAAAGCCCCTCCTCATACTGG - Intronic
1083583859 11:63842155-63842177 TCCAAAGTCCCTGCTTTTACTGG - Intronic
1083614186 11:64018335-64018357 TCCTCAGCTCCTCCTTTCCCTGG + Intronic
1083881138 11:65548830-65548852 TTAACAGCCCCTCCTTTGAGGGG + Intronic
1085808741 11:79660905-79660927 TCATCAGCCCCTCTTTTTATTGG - Intergenic
1088186608 11:107177534-107177556 GCCCCAGCTCCTCCTTGTACGGG - Intergenic
1089733743 11:120535422-120535444 TCCCTACCCCCTCCTTTTACAGG - Intronic
1090351263 11:126110053-126110075 ACCACAGCCCTTCCTGTTATGGG + Intergenic
1090531252 11:127593198-127593220 TCCAGAGCTCCCTCTTTTACTGG + Intergenic
1090632026 11:128657750-128657772 TCCTCAGCATCTCCTTTTTCAGG + Intergenic
1091864535 12:3820025-3820047 TCCACATCCCCTACTTTTGTTGG + Intronic
1093324799 12:17760263-17760285 ACGACAGCCCCTCCCATTACAGG - Intergenic
1093528292 12:20130956-20130978 TACACAGCCTCTCCTTTTCAGGG - Intergenic
1094483962 12:30909269-30909291 GCCACAGCCTCTCCTCTGACTGG + Intergenic
1098190666 12:67945175-67945197 TCCTCAGCCCCTCCTCCTCCAGG - Intergenic
1098394317 12:70002464-70002486 TCCACACCCTCTCCTTTGCCAGG - Intergenic
1101589591 12:106113820-106113842 TCCACAGGCCCTCCTTGGGCTGG - Intronic
1101829528 12:108246535-108246557 TCCCCAGCTCCTCCTTCTGCGGG + Intronic
1101953165 12:109191942-109191964 GCCACAGCCCCTACCTTTCCAGG - Exonic
1102568273 12:113811486-113811508 CATACAGCCCCTCCTTCTACAGG - Intergenic
1104903784 12:132203034-132203056 TCCTCAGCGCCACCTTTTCCAGG - Intronic
1105457466 13:20554699-20554721 TGCCCACCCCCTCCTTTTGCAGG + Intergenic
1105809570 13:23982991-23983013 TCTCCAGCTCCTCCTTTCACTGG - Intronic
1107131306 13:36899208-36899230 TCCACCGCCCCACCTTTTTTTGG - Intronic
1107318665 13:39161982-39162004 TCCATTGCCTCTCCTTTTCCTGG + Intergenic
1111219035 13:85180498-85180520 GCCACAGCCCCTCCTGTTATAGG + Intergenic
1111622822 13:90746452-90746474 TCCACATTCCTTCTTTTTACAGG + Intergenic
1119016451 14:71061421-71061443 TCCACACATCCTCCTTTTATTGG + Intronic
1120264393 14:82231152-82231174 TCCAGTGACTCTCCTTTTACAGG - Intergenic
1122031399 14:98915213-98915235 CCCTCAGCCCCTCCATTTCCAGG - Intergenic
1122379991 14:101295914-101295936 AGCACAGCCCCTCCTATCACAGG - Intergenic
1122689725 14:103526449-103526471 TCCACAGCCCCTGCTCTCCCTGG + Intergenic
1124001963 15:25767470-25767492 AGCACAGCCCCTCCTCTGACTGG + Intronic
1125717106 15:41825648-41825670 TCCACAGCCCCTCCAGTGGCAGG + Exonic
1127010860 15:54626034-54626056 TCCAAATTCCTTCCTTTTACAGG - Intronic
1127345418 15:58092000-58092022 TCCAGAGCCTCTCCGTTTCCTGG - Intronic
1128613393 15:69091210-69091232 GCCACAGGCCCTCCTTCCACAGG + Intergenic
1129276996 15:74452302-74452324 TGCACAGCAGCTCCTCTTACAGG - Exonic
1130911727 15:88275554-88275576 TCCACGCTCCCTCCTTTTTCAGG + Intergenic
1132522889 16:399545-399567 TCCAGGGCCCCTCCCTTTGCTGG - Intronic
1133756922 16:8768864-8768886 TCGACATCCCTTCCTTTGACTGG + Exonic
1134628060 16:15737049-15737071 TCCCCAGCCCCTCCCTCTAAGGG - Intronic
1136731558 16:32418245-32418267 ACGACAGCCCCTCCTGTCACAGG + Intergenic
1137786120 16:51139310-51139332 TCCAAAGCCCCACCATTCACTGG + Exonic
1140855359 16:78973124-78973146 TCCGCAACCCCACCTTATACGGG - Intronic
1141476362 16:84276184-84276206 TGCACAGCCCCTCCCTGTCCTGG - Intergenic
1142408507 16:89904303-89904325 ACCACAGCCCCTCCTGCTGCTGG - Intronic
1202994832 16_KI270728v1_random:99025-99047 ACGACAGCCCCTCCTGTCACAGG - Intergenic
1203021519 16_KI270728v1_random:411367-411389 ACGACAGCCCCTCCTGTCACAGG - Intergenic
1142938792 17:3363059-3363081 TTCACAGCCTCTCCTATCACAGG - Intergenic
1145002520 17:19315194-19315216 TGCCCAGCCCCTCCTTTGGCTGG + Intronic
1145883565 17:28368282-28368304 GCCACAGCCCCTCCCTCTGCTGG + Intronic
1145921888 17:28615798-28615820 TCCCCTCCCCCTCCTCTTACAGG - Exonic
1146355384 17:32129447-32129469 TCAACATGCCCTCATTTTACGGG - Intergenic
1146565463 17:33909223-33909245 CCCACAGCTCCTCTTGTTACAGG - Intronic
1147911953 17:43861270-43861292 TCCTCAGCCCCTCCCTTCCCAGG - Intronic
1148741287 17:49894604-49894626 TCCCTAGCCCCTGCTCTTACAGG + Intergenic
1148891565 17:50811297-50811319 TACACAGCCCCTCCTATGGCTGG - Intergenic
1149775499 17:59353776-59353798 TCCCCAGCCCCTCCCTTCTCTGG - Intronic
1149793103 17:59496179-59496201 TCCACAGCCCCAGCCCTTACTGG - Intergenic
1152043953 17:77923768-77923790 TCCAGATCCCCTCCATTTGCAGG - Intergenic
1152423710 17:80207803-80207825 TCCACTGACCCTCCACTTACTGG + Intronic
1152710775 17:81869661-81869683 TCCCCAGCCCCTACTTCCACTGG - Intronic
1152729520 17:81962616-81962638 TCCAGAGCCCCTCCTAATTCAGG + Intergenic
1153935733 18:9919634-9919656 TTCACAGTCCCTCCTGCTACCGG - Intronic
1153990720 18:10397065-10397087 TCCACAGCCTCTTATTTTTCAGG + Intergenic
1158598757 18:58839058-58839080 TCAACAGCCCCTCCTTTTGTTGG - Intergenic
1160033947 18:75284548-75284570 TCCCCATCCCCTCCTTCTCCTGG + Intronic
1160313883 18:77822238-77822260 ACCACAGCCCCACATTTTCCCGG + Intergenic
1161919350 19:7254624-7254646 CACACATCACCTCCTTTTACTGG + Intronic
1162786771 19:13040005-13040027 TCCACTGCCCCTCCTCTGTCAGG - Intronic
1162819514 19:13214106-13214128 TGCACAGCCCCTACTTTTCAGGG + Intronic
1163109812 19:15152816-15152838 TCCTCAGCCCCTCCCTTTTTAGG - Intergenic
1165080800 19:33304889-33304911 TCCACAGCGCCACCTTGTTCAGG - Intergenic
1167689067 19:50974760-50974782 TCCCCAGCCCCTTCTGTTTCTGG - Intergenic
1167799900 19:51733534-51733556 CCCACACCCCCTCCCTTGACAGG - Intergenic
1168672142 19:58248670-58248692 TCCCCAGCCCCTGGTGTTACTGG + Intronic
925730512 2:6917269-6917291 TCCGCAGCCCCTCCTCGTGCCGG + Intergenic
926382837 2:12307675-12307697 TTCACAGCCACTTCTTTCACTGG + Intergenic
927084576 2:19661764-19661786 GCCACAACCCCTCATTTTATAGG - Intergenic
928222078 2:29412184-29412206 CCCACACATCCTCCTTTTACTGG - Intronic
929224485 2:39499101-39499123 TCTCCAGCCCCTCCTTGTAGAGG - Intergenic
929827376 2:45319710-45319732 ACCACAGCCCCTCCTGTAAGTGG + Intergenic
930104863 2:47631865-47631887 TCCACAGCCTCTGGTTTTAAAGG - Intergenic
931149691 2:59559381-59559403 TCCACAGCCCCTTCATCAACCGG + Intergenic
932633985 2:73371895-73371917 TCCACTGCACCCCCTTTTACTGG + Intergenic
933108045 2:78358251-78358273 TTCCCAGACCCTCATTTTACTGG + Intergenic
933508164 2:83204547-83204569 ACAGCAGCCCCTCCTATTACAGG - Intergenic
933729428 2:85445956-85445978 TCCTCAGCCCCTCCATTTCCAGG - Intergenic
933729525 2:85446379-85446401 TCCTCAGACCCTCCATTTCCAGG + Intergenic
934165348 2:89289145-89289167 TCCACAGTACTTCATTTTACAGG - Intergenic
934201926 2:89893317-89893339 TCCACAGTACTTCATTTTACAGG + Intergenic
935684313 2:105670032-105670054 TCCCCAGACCCTCCTTTCAGAGG - Intergenic
936405359 2:112197993-112198015 TCCATAGCCCTTCCTGTTCCTGG - Intergenic
940693953 2:156955956-156955978 TCTACAGGTCCTCCTATTACAGG + Intergenic
944192425 2:197017835-197017857 TCCAGAGCCCTTCCTTGTTCAGG - Intronic
946577025 2:221086740-221086762 ACAGCAGCCCCTCCTATTACAGG - Intergenic
947006472 2:225517361-225517383 TGCACACTCCCTCCTTTTGCTGG - Intronic
947138784 2:227001489-227001511 TGCAAAGCCCCTTGTTTTACGGG - Intergenic
1172257787 20:33535142-33535164 ACCACAGCCTCAACTTTTACAGG - Intronic
1173761208 20:45562186-45562208 TCCATAGCCCCACCTTCTCCTGG - Exonic
1173926906 20:46787551-46787573 CCAAGAGCCTCTCCTTTTACAGG + Intergenic
1175578608 20:60081125-60081147 TCCTCAGCACCTCCTTCCACCGG - Intergenic
1176013621 20:62915161-62915183 TCCAACTCCCCTCCTTTTAAAGG + Intronic
1176160157 20:63643623-63643645 GCCACAGCCCCTCCTGCTCCAGG + Intronic
1177657192 21:24033386-24033408 TCCACATGACCTCCTTTAACGGG - Intergenic
1180036519 21:45253081-45253103 TCCTCACCCCCTCCTCTTACAGG - Intergenic
1180953133 22:19729768-19729790 TCCACAATCCCTCCTCTTGCCGG + Intergenic
1181456093 22:23061014-23061036 TCCACAGCCCCTCCTTTTACTGG - Intronic
1181744757 22:24948272-24948294 TCCAGACGCCCTCATTTTACAGG - Intergenic
1181928624 22:26380834-26380856 TCCACAGCCCCTCCCTCTCACGG + Intronic
1183310561 22:37107330-37107352 TCCACTGCCCCTCCTCCTGCTGG - Intronic
1183406501 22:37632958-37632980 TACACAGCCCCTCCCTCTCCAGG - Exonic
1183811240 22:40259585-40259607 TCCACTCCCCCTCCCCTTACTGG + Intronic
1183856289 22:40637028-40637050 TCCACCGCCCTTCCCTTCACAGG - Intergenic
1183937116 22:41269201-41269223 TCCACAGTACCTGCTATTACAGG + Intronic
1184658821 22:45955923-45955945 GCGGCAGCCCCTCCTTGTACAGG - Intronic
950436474 3:12983430-12983452 TCCCCAGCCCCACCTCTCACTGG + Intronic
953128066 3:40110667-40110689 TCAACAGCCCCTCTTTTCACAGG + Intronic
954920681 3:54188276-54188298 TGCACAGCCTCTCCTGCTACTGG - Intronic
956667675 3:71657301-71657323 TCCACAGGCTCTCCTGTTAACGG + Intergenic
957403086 3:79742250-79742272 TCAACAGACCCTCCTGTTACAGG + Intronic
957737014 3:84215592-84215614 ACCACAGCCCCTCCCATCACAGG - Intergenic
958840565 3:99199573-99199595 TCCACAACCCCTCTTTTTTTAGG + Intergenic
960042753 3:113167143-113167165 TCCACAGCCCCGGCTTTCCCAGG + Intergenic
961313262 3:126017253-126017275 TCGACAGCCCCTGCTTAGACAGG + Intronic
962060029 3:131916070-131916092 GTCACAGCCCCTCCTTTTCCCGG + Intronic
963661224 3:148130865-148130887 TCAAAAGCCCCTACTTTAACTGG - Intergenic
964524291 3:157601388-157601410 TCCACAGCCCCTCATTTCTCTGG - Intronic
966966664 3:185001571-185001593 TCCTCAACCCCACCATTTACAGG + Intronic
968003650 3:195224806-195224828 GCCGCAGCCCCTCATTTCACAGG + Intronic
968748753 4:2375236-2375258 TCCTCAAGCCCTCTTTTTACAGG + Intronic
968983796 4:3864813-3864835 TCCAAAGCCCCTCATTCTCCAGG + Intergenic
972657265 4:41076486-41076508 TCCACAGCCCCTTCCTCTGCTGG + Intronic
974425718 4:61741001-61741023 TACACAGCCACAGCTTTTACTGG - Intronic
976601381 4:86940792-86940814 TGCCCAGCCCCTCCCTTCACAGG - Intronic
978419225 4:108512176-108512198 TCCACATCCCCTACGTTTCCTGG + Intergenic
985746443 5:1651503-1651525 TCCCCAGCCCCACCCTTTTCTGG - Intergenic
988289227 5:29264021-29264043 TCCACACTCCCACCCTTTACTGG - Intergenic
988396271 5:30700867-30700889 TCCACAGACCCTCCCATCACAGG + Intergenic
988922647 5:35958389-35958411 TCCTGAGCCCCTCATTCTACTGG + Intronic
989191736 5:38676978-38677000 TCCACATCCGCTCTTTTTAAAGG + Intergenic
990213768 5:53508330-53508352 GCGACAGCCCCTCCCTTCACAGG - Intergenic
990794466 5:59524673-59524695 ACAGCAGCCCCTCCTATTACAGG + Intronic
991408896 5:66327733-66327755 TCCTCAGCCCCTTCTGTTTCAGG - Intergenic
993061976 5:83049695-83049717 TTCACAGCCCCTCTGTTTCCTGG + Intergenic
996508087 5:124289780-124289802 CCCACAGCCCCTCCTCTGGCTGG + Intergenic
997327426 5:133033629-133033651 TTCACAGCACCTCCTCTCACTGG - Intergenic
999623351 5:153494109-153494131 CCCACAGGCCCTCCTTTCATTGG - Intronic
1000015708 5:157273644-157273666 TCCACAGCCTCTGCTTGTAGGGG + Intronic
1000561738 5:162798121-162798143 TACACACCCACTCCTTTTAAAGG - Intergenic
1001757479 5:174181580-174181602 TCAAAAGACCCTTCTTTTACAGG + Intronic
1002236785 5:177808620-177808642 TCCACAGCCCGTCCCGCTACCGG - Intergenic
1002848811 6:972775-972797 TCCCCAGCCTCATCTTTTACAGG + Intergenic
1003075567 6:2981070-2981092 TCCCCAGCCCGTCCTTGTAGAGG - Intergenic
1007717239 6:43864391-43864413 TCCACAGCCCCACCTGTAAGGGG + Intergenic
1008022519 6:46596729-46596751 ACCCCACCCCCTCCTTTTTCAGG - Intronic
1010442362 6:75910846-75910868 TACACAGCACTTCCTTTTAAAGG - Intronic
1012058010 6:94440268-94440290 TACATAGCTCCTCCTCTTACAGG - Intergenic
1014837261 6:126173616-126173638 TCCACAGCCCATACTTTTTAAGG - Intergenic
1016815560 6:148299760-148299782 TTCTCAGCCCCTCCTAATACAGG - Intronic
1017942201 6:159062863-159062885 TTCATGGCCCCTCCTTTTGCAGG + Intergenic
1018784273 6:167095968-167095990 TCCACAGCTCCTCCCATTGCAGG + Intergenic
1020152721 7:5696014-5696036 GCCACAGCCCCTCCTTCAAGTGG - Intronic
1021427571 7:20519904-20519926 AGCACAGCCCCTCCTTTCATGGG - Intergenic
1021452193 7:20793497-20793519 ACCACACCCCCTGCTTTTCCTGG - Intergenic
1022678341 7:32521773-32521795 ACCACAGCCCCTCCTATCACAGG + Intronic
1023866160 7:44239366-44239388 AGCCCAGCCCCTCCTCTTACAGG + Intronic
1026763327 7:73143067-73143089 TCCACAGCCACACCTTCTGCAGG + Intergenic
1026841554 7:73672060-73672082 TCCCCAGCCCCGCCTCTTAGGGG + Exonic
1027039797 7:74952857-74952879 TCCACAGCCACACCTTCTCCAGG + Intergenic
1027083844 7:75249523-75249545 TCCACAGCCACACCTTCTCCAGG - Intergenic
1028011432 7:85649032-85649054 ACAACAGCCCCTCCTATCACAGG - Intergenic
1029391438 7:100277365-100277387 TCCACAGCCACACCTTCTCCAGG - Intergenic
1031197732 7:118638120-118638142 ACCACAGCCTCTCATTATACCGG + Intergenic
1031557731 7:123198805-123198827 TGCACAGTCCCTCCTCTTAATGG - Intronic
1037785170 8:21898648-21898670 TCCACTGCCCCTCATGCTACTGG + Intergenic
1040726386 8:50386260-50386282 TCCACAGCCCCTCTTCTGATTGG + Intronic
1041370094 8:57150067-57150089 TCCACAGCCACTTCTCTTCCAGG - Intergenic
1042001227 8:64125260-64125282 TCCATAGCCCCTACTTTAACTGG + Intergenic
1042384359 8:68155709-68155731 TCCATAGCCATTCCTGTTACTGG + Intronic
1043919225 8:85962055-85962077 GCCCCAGCCCCTGCTTTTCCAGG + Intergenic
1044788430 8:95821527-95821549 TACAAAGCCCCAGCTTTTACTGG - Intergenic
1047203845 8:122787773-122787795 GCTACAGCCCCTCCTTGTCCTGG + Intronic
1047856971 8:128921463-128921485 TCCACAGTCCATCTTTCTACAGG - Intergenic
1048200293 8:132368045-132368067 GCAACAGCACCTCCTTTCACAGG + Intronic
1048901780 8:139044720-139044742 TCCACAGCCACTGCTGTCACTGG - Intergenic
1049007166 8:139862975-139862997 TGCACAGCCCCTCCTCTGCCAGG + Intronic
1050716104 9:8527954-8527976 TAAAAATCCCCTCCTTTTACTGG + Intronic
1050894808 9:10872926-10872948 ACAATAGCCCCTCCTATTACAGG - Intergenic
1052297760 9:26917096-26917118 CCCACAGCAGATCCTTTTACAGG - Exonic
1052317351 9:27129422-27129444 TCCACAGCCCCTACTATTCCTGG + Intronic
1053296443 9:36917622-36917644 ACCACAGCCTCAACTTTTACAGG + Intronic
1057418556 9:94888379-94888401 TACATAGGCCCTCCTTGTACAGG - Intronic
1057910573 9:99016904-99016926 CCCACAGCCCCTCCCCTCACAGG - Intronic
1057917617 9:99069172-99069194 CACACAGCTCCTACTTTTACAGG + Intronic
1058067771 9:100567930-100567952 TGCACAGGCCCTCTCTTTACTGG - Intronic
1060796299 9:126514789-126514811 TCAACAGTCCCTCCTTTAAAAGG + Intergenic
1061231547 9:129318719-129318741 TCCACAGCCCCTCCATGTCTGGG + Intergenic
1061669500 9:132180615-132180637 TGCAGACCCCCTCATTTTACAGG - Intronic
1186680996 X:11874263-11874285 GCCACAGCCCCTCCTGTAGCTGG + Intergenic
1188688461 X:33099290-33099312 TCCTCAGCTCCTCCATTTCCAGG + Intronic
1189035161 X:37487983-37488005 ACAACAGCCCCTCCCTTCACAGG - Intronic
1190362873 X:49665878-49665900 TCCAAAGCCCCGCCATTCACTGG + Intergenic
1194054736 X:89117469-89117491 TCAGCAGCCCCTTCCTTTACAGG - Intergenic
1195709224 X:107760628-107760650 TCCTGAGCCCCTCCCTTTTCAGG - Intronic
1197386974 X:125813949-125813971 TCTATAGCCCCTACTTTAACTGG + Intergenic
1198178494 X:134180834-134180856 TCCCCACCCCAGCCTTTTACAGG + Intergenic
1198701127 X:139399011-139399033 TCCATAGCCCCTACTTTAACTGG - Intergenic
1199561997 X:149172759-149172781 ACAACAGCCACTCCTATTACAGG - Intergenic
1199618555 X:149678678-149678700 GGCACATCCCCTCCTTCTACAGG - Intergenic
1199624087 X:149724571-149724593 GGCACATCCCCTCCTTCTACAGG + Intergenic