ID: 1181457217

View in Genome Browser
Species Human (GRCh38)
Location 22:23066695-23066717
Sequence TTTCCCCGATTGTTTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 177}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181457217_1181457230 19 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457230 22:23066737-23066759 GCCTGAGCGTCCGCTGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 134
1181457217_1181457235 23 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457235 22:23066741-23066763 GAGCGTCCGCTGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 35
4: 328
1181457217_1181457232 20 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457232 22:23066738-23066760 CCTGAGCGTCCGCTGGGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1181457217_1181457236 26 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457236 22:23066744-23066766 CGTCCGCTGGGGGTGGGGGGTGG 0: 1
1: 0
2: 13
3: 86
4: 940
1181457217_1181457233 21 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457233 22:23066739-23066761 CTGAGCGTCCGCTGGGGGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 232
1181457217_1181457222 -6 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457222 22:23066712-23066734 GGGAAATCCACCCAACTGGGCGG 0: 1
1: 0
2: 2
3: 8
4: 109
1181457217_1181457234 22 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457234 22:23066740-23066762 TGAGCGTCCGCTGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 43
4: 334
1181457217_1181457229 16 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457229 22:23066734-23066756 GCAGCCTGAGCGTCCGCTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1181457217_1181457227 14 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457227 22:23066732-23066754 CGGCAGCCTGAGCGTCCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 108
1181457217_1181457228 15 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457228 22:23066733-23066755 GGCAGCCTGAGCGTCCGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1181457217_1181457226 13 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457226 22:23066731-23066753 GCGGCAGCCTGAGCGTCCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 143
1181457217_1181457221 -9 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457221 22:23066709-23066731 TCGGGGAAATCCACCCAACTGGG 0: 1
1: 0
2: 0
3: 1
4: 104
1181457217_1181457220 -10 Left 1181457217 22:23066695-23066717 CCCCAGGGAAACAATCGGGGAAA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1181457220 22:23066708-23066730 ATCGGGGAAATCCACCCAACTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181457217 Original CRISPR TTTCCCCGATTGTTTCCCTG GGG (reversed) Intronic
900467896 1:2834766-2834788 TTTTCCTGATATTTTCCCTGGGG - Intergenic
900520338 1:3102300-3102322 TGTCCCCTCTGGTTTCCCTGGGG + Intronic
901035898 1:6335806-6335828 TTTCCCATATTATTTGCCTGTGG - Intronic
901518666 1:9766818-9766840 TCGCCCGGATTGTTTCCTTGGGG - Intronic
903845608 1:26278285-26278307 TTTCCTGGGTTGTTTCTCTGGGG + Exonic
905910857 1:41653151-41653173 TTTCCCCAAATGTTTTTCTGTGG + Intronic
906741117 1:48186553-48186575 TCTCCCCAATTCTTCCCCTGGGG + Intergenic
908869693 1:68594711-68594733 TTTCATCAATTGTTTCACTGAGG + Intergenic
909574754 1:77160968-77160990 TCTCCCCGAATTCTTCCCTGTGG - Intronic
912520011 1:110238836-110238858 TGTTCACCATTGTTTCCCTGAGG - Intronic
916012309 1:160717380-160717402 TCTCCCTGATTCTTTCCTTGGGG - Intergenic
916715074 1:167441193-167441215 TTTGACCTATTGTCTCCCTGTGG - Intronic
918001926 1:180505513-180505535 TCTCCCCGATTCTTCCCTTGGGG - Intergenic
920682792 1:208085371-208085393 ATTCCCCTAGTGATTCCCTGTGG - Intronic
921981706 1:221265702-221265724 TTTGACTGATTGTTTCCTTGTGG + Intergenic
922962137 1:229656791-229656813 TTTCCCTGCATGTTTCCATGGGG - Intronic
923261435 1:232272006-232272028 TTTCCCCCTTTGTTTCCATAAGG + Intergenic
923335072 1:232961258-232961280 TAGCCATGATTGTTTCCCTGGGG + Intronic
924929975 1:248721876-248721898 TGTCCCCCATTGACTCCCTGGGG - Intronic
1063567579 10:7184299-7184321 TTTCCCCCATACTTTTCCTGTGG + Intronic
1070486861 10:76939873-76939895 CTTGCCAGACTGTTTCCCTGTGG - Intronic
1071510128 10:86256202-86256224 TTTCCCCTATTGTCACCCTGAGG + Intronic
1072828223 10:98630098-98630120 CTTCCCCCATTGCTCCCCTGTGG + Intronic
1074473979 10:113753164-113753186 TTTCTCCGATTGGATCCTTGAGG + Intronic
1076232874 10:128836360-128836382 TTTCTCTGATGGTTTCCATGTGG - Intergenic
1076705071 10:132297057-132297079 TTTCACCTTTTGTTTCCTTGTGG + Intronic
1081069947 11:38598573-38598595 GTTCTCTGACTGTTTCCCTGCGG + Intergenic
1086145289 11:83544883-83544905 TTTCCCCACTTGTTGCCCTCTGG + Intronic
1086342288 11:85858481-85858503 TGTCCCCTATTGACTCCCTGGGG + Intronic
1089031274 11:115332019-115332041 TTTCCCCGACTGTTACGCTCAGG - Intronic
1093255079 12:16856873-16856895 TTTTTCCTATTGTTTCCCAGAGG - Intergenic
1094324374 12:29220944-29220966 TCTCCCCGATTCTTCCCTTGGGG + Intronic
1096633306 12:52943532-52943554 TTTCCCTGATCCTTTCCCTTAGG + Intronic
1097909019 12:64949256-64949278 TTTTCCCCATGGTTTCCATGTGG + Intergenic
1099763738 12:86955290-86955312 TTTCCCCCAATATTTTCCTGTGG + Intergenic
1102488743 12:113276204-113276226 GGTCCCCCATTTTTTCCCTGTGG - Intronic
1103967420 12:124648708-124648730 TTTCACCAATTGTTTCCTTACGG - Intergenic
1106190211 13:27445836-27445858 TTTGTCAGATTGTTTCCTTGTGG - Intronic
1106246759 13:27956628-27956650 TTTCCTTGTTTGCTTCCCTGAGG + Intergenic
1106317658 13:28609204-28609226 TTTCCCAGGTTCGTTCCCTGTGG + Intergenic
1106637196 13:31541852-31541874 TTTCTCAGAATGTATCCCTGAGG - Intergenic
1107438573 13:40403829-40403851 TTTCCCTGATTGTTTGGCTGAGG - Intergenic
1107961049 13:45558964-45558986 ATTCCCTCTTTGTTTCCCTGTGG + Intronic
1108269489 13:48745763-48745785 TTTCCCTTCTTGTTGCCCTGGGG - Intergenic
1109208529 13:59508479-59508501 TTTCCCCAAATCTTTCACTGGGG + Intergenic
1110527580 13:76556731-76556753 TTTCCCTGACTGTTTTCTTGAGG + Intergenic
1112499778 13:99933808-99933830 TTTCCACGCTTGTTCTCCTGTGG - Intergenic
1114901430 14:27064403-27064425 TTTCACTGATTGTTTCCTTGTGG - Intergenic
1115963681 14:38863627-38863649 TTTCCCCCATTGTAAGCCTGGGG - Intergenic
1116229802 14:42201993-42202015 TCTCCCCGATTTTTCCCTTGGGG - Intergenic
1116675349 14:47899481-47899503 TTCCCTCGATTGTTTCCTTGAGG - Intergenic
1117197224 14:53352818-53352840 TTGCCCCGATTCTTCCCTTGGGG - Intergenic
1117583640 14:57178049-57178071 CTTCCCAGAGTTTTTCCCTGAGG - Intergenic
1117906783 14:60597583-60597605 TTTGTCTGATTGTTTCCTTGTGG + Intergenic
1118103694 14:62634098-62634120 TTTACCGCATTGTATCCCTGAGG + Intergenic
1118399473 14:65366417-65366439 TTTCCCCGATGGCTTCTGTGGGG + Intergenic
1118529793 14:66690883-66690905 TTTCTCAGAATGTATCCCTGTGG + Intronic
1119034329 14:71216886-71216908 TTTCCCCTACTGTTTCCTTTGGG - Intergenic
1119559316 14:75578074-75578096 TTTACTCGCTTCTTTCCCTGCGG - Intergenic
1121019674 14:90571978-90572000 TTTTCCAGTTTGTGTCCCTGTGG - Intronic
1124551433 15:30684536-30684558 TTTCTCAGATTGTATCCCTGTGG - Intronic
1124679815 15:31721129-31721151 TTTCTCGGATTGTATCCCTGTGG + Intronic
1125586432 15:40823797-40823819 TTTCACAGAATGTATCCCTGTGG + Intronic
1125758918 15:42084072-42084094 TTTCTTCTCTTGTTTCCCTGTGG + Intronic
1125844136 15:42835427-42835449 TTTTGCTGGTTGTTTCCCTGTGG - Intronic
1126183988 15:45812473-45812495 TTTCCAGGATTGGTCCCCTGTGG - Intergenic
1129243408 15:74265279-74265301 TCTCCCCAAGTGTTTCCCTCAGG + Intronic
1131799168 15:96052286-96052308 ATGCCCTTATTGTTTCCCTGTGG - Intergenic
1133223654 16:4329683-4329705 TGCCCCCGTGTGTTTCCCTGGGG - Intronic
1133879033 16:9763527-9763549 TTTCCCCGAGAGTTTGCTTGAGG + Exonic
1140832115 16:78761526-78761548 CTACCCTGATAGTTTCCCTGTGG + Intronic
1141029835 16:80578111-80578133 TTTCCTCTTTGGTTTCCCTGCGG - Intergenic
1146603541 17:34238610-34238632 CTTCCCCCATTGTTGCCCTGTGG - Intergenic
1147714595 17:42496860-42496882 TTTCGCTGATTGTAGCCCTGTGG - Intronic
1148614879 17:48994707-48994729 CTTCTCAGATTGTCTCCCTGGGG - Intergenic
1151331042 17:73408631-73408653 TTTCGCTGATTGCATCCCTGTGG - Intronic
1151820806 17:76495841-76495863 TTTCCCAGAACGTTGCCCTGGGG + Intronic
1151942483 17:77301129-77301151 CTCCCCCGTTTGTTTCCCTGTGG - Intronic
1153467609 18:5406530-5406552 TTTTCACGATAGTCTCCCTGTGG + Intronic
1159824341 18:73188325-73188347 TTTCCCCCATGCTTTTCCTGTGG + Intronic
1162005140 19:7773464-7773486 CTTCCCTGATTCTTTCACTGGGG + Intergenic
1165692439 19:37874062-37874084 CTTCCCTGATTCTTTCCTTGGGG + Intergenic
1167222894 19:48214607-48214629 CTTCCCTGATTCTTCCCCTGGGG - Intronic
1167409708 19:49337670-49337692 TTTTCCCGTGTGTTTCCCTTTGG - Intronic
925662096 2:6213427-6213449 TTTCCCCTAAAGTCTCCCTGGGG + Intergenic
926122747 2:10253811-10253833 TTTCCCTGTTTATTTCCCTGGGG + Intergenic
926161226 2:10491039-10491061 TTTCCCTGTCTGTTTCCCTCAGG - Intergenic
927050867 2:19327314-19327336 TTTCCCCAAGTGTTACCATGTGG - Intergenic
927243114 2:20935850-20935872 TTTCGTCCATTGATTCCCTGGGG - Intergenic
927698081 2:25251296-25251318 TTTCTCTTATTGTTTGCCTGGGG - Intronic
930729252 2:54711656-54711678 TTTTGCTGATTGTATCCCTGGGG + Intergenic
931096563 2:58947241-58947263 TTTCCTGGATTGCTTTCCTGAGG + Intergenic
931893356 2:66700442-66700464 AATGCCCCATTGTTTCCCTGTGG - Intergenic
934050670 2:88207883-88207905 TTTTCCCGATTGGATCCCTCTGG - Intergenic
935286440 2:101567876-101567898 CTTCCCTGATTGTTCCCTTGGGG + Intergenic
935930413 2:108118044-108118066 TTTCCCGGATTATTTACCAGAGG + Intergenic
936585369 2:113752581-113752603 TTTGGCTGATTGTTTCCTTGGGG - Intronic
936956656 2:118029239-118029261 TCTCCCCGATTCTTCCCTTGGGG - Intergenic
939207691 2:139128735-139128757 ATTCCCTGATTCTTTCCTTGGGG + Intergenic
940857667 2:158742151-158742173 TTCTCCCGATTCTTTCCTTGGGG - Intergenic
941029624 2:160495355-160495377 TTTCCCATATTGTTTCAATGTGG + Intergenic
1169288596 20:4330038-4330060 TTTCCCAGCTTTTTTCCCGGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171740317 20:28876743-28876765 TTTCCCAGAATGTTTCTATGTGG + Intergenic
1173304413 20:41834792-41834814 TTTCCCTGCTTGTTTTCCTGGGG - Intergenic
1173875704 20:46369782-46369804 TTTTGCTGATTGTTTCCCCGTGG - Intronic
1173992651 20:47315182-47315204 TTTCCCCCTTTGTTTCCTGGTGG - Intronic
1174389674 20:50210467-50210489 GTTCACCCATTGTTTCTCTGTGG - Intergenic
1179009973 21:37549000-37549022 TCTCCCCGATTCTTCCCTTGGGG + Intergenic
1180165261 21:46022479-46022501 CTTCCACGCTTGTTCCCCTGGGG + Intergenic
1181457217 22:23066695-23066717 TTTCCCCGATTGTTTCCCTGGGG - Intronic
1183902101 22:41013874-41013896 TTTTCCTGATTGCATCCCTGTGG + Intergenic
1184722004 22:46320248-46320270 TTTCCCAGAGCGTGTCCCTGCGG + Intronic
949156914 3:838847-838869 TTTCCCTTCTTGTTTCTCTGGGG + Intergenic
950261542 3:11545869-11545891 ATACCCCCATTGTTTCCCGGAGG + Intronic
952137881 3:30444017-30444039 TTACCACGATGGTTTCCCAGAGG - Intergenic
953085972 3:39667748-39667770 TTTCCCAGATTCTTCCCCTCAGG + Intergenic
955333375 3:58065719-58065741 TTTCCTCGAGGGATTCCCTGTGG + Intronic
955532441 3:59888071-59888093 TATCCCCAATTTGTTCCCTGAGG + Intronic
956712573 3:72051346-72051368 TTTGGCTGATTGTTGCCCTGTGG - Intergenic
957166792 3:76684428-76684450 TATCCCCTACTCTTTCCCTGTGG - Intronic
962882221 3:139588853-139588875 TTTCCCAGAATGTCTCTCTGGGG + Intronic
963945378 3:151140504-151140526 TGTGCCCGATTGTTGCCCTGTGG + Intronic
965604922 3:170488744-170488766 TTTCCCCCAATGTTTTCTTGTGG - Intronic
967480269 3:189964663-189964685 TTTACACTATTGTTTCCCAGTGG + Intronic
970302710 4:14698206-14698228 TTTCTCAGGTTGTTTCCTTGTGG - Intergenic
972381838 4:38526597-38526619 TTTCCTTGTTTGTTTCCCTCAGG - Intergenic
973182530 4:47287226-47287248 TTTCCCCGTATCTTTCCCTTTGG + Intronic
974129623 4:57737631-57737653 TTTCCCCTTTTGTTTGCTTGGGG - Intergenic
974223814 4:59012180-59012202 TTTTCCCGATGTTTTCCCTTAGG + Intergenic
978938600 4:114410429-114410451 CTTCTCTGATTGTTTCCTTGGGG + Intergenic
981143759 4:141301477-141301499 CTTCCCTGATTGTTTTACTGGGG - Intergenic
983336364 4:166398552-166398574 TTTACCCAGTTGTTTTCCTGGGG + Intergenic
983891939 4:173038458-173038480 TTTCTCAGAGTCTTTCCCTGGGG + Intronic
985833656 5:2254553-2254575 TTTCCTCGATTCTCTCTCTGAGG + Intergenic
986538053 5:8813309-8813331 CTCCCCTGATTCTTTCCCTGGGG - Intergenic
987878414 5:23710823-23710845 TTCCCCTGATTCTTTCCTTGGGG + Intergenic
989433385 5:41381827-41381849 TTTCTGTGATTGTTTCTCTGAGG + Exonic
990893358 5:60671592-60671614 TTTCCCCTCTGCTTTCCCTGAGG + Intronic
991987193 5:72301140-72301162 TTTCCTCTCTTTTTTCCCTGAGG + Intronic
993334422 5:86639885-86639907 TTTCTCCTATTGTTTACATGAGG + Intergenic
993364848 5:87022616-87022638 TTTCCCTGATTCTTCCCTTGGGG - Intergenic
996456573 5:123690955-123690977 TTTCCCTGCTGGTTTCACTGTGG + Intergenic
997261584 5:132469485-132469507 TATCCCAGATGGTTTCCCAGTGG - Intronic
999631513 5:153576527-153576549 TTTCCTGAATTGTTTCCCTGCGG + Intronic
999968909 5:156839330-156839352 TTTCCCTCATTCTTTGCCTGTGG - Intergenic
1001850643 5:174961992-174962014 TTGGACCTATTGTTTCCCTGGGG + Intergenic
1005653210 6:27904107-27904129 TTTCACCAATTTTTGCCCTGTGG + Intergenic
1008326274 6:50185677-50185699 TTTCCCCCTTTATTTCCCTTGGG - Intergenic
1014288139 6:119526745-119526767 TTTGACAGATTGTTTCACTGTGG + Intergenic
1014768401 6:125433936-125433958 TCTCCCCGATTCTTCCCTTGGGG + Intergenic
1014975581 6:127877931-127877953 TTTTCCTGATCCTTTCCCTGTGG - Intronic
1015156556 6:130102715-130102737 TTTCCCACATTGTTTCCCTACGG + Intronic
1016944466 6:149515820-149515842 TTTCTCCAATTTCTTCCCTGAGG + Intronic
1017012908 6:150075184-150075206 TTTCTTCCATTGTTTCTCTGGGG + Intergenic
1018664799 6:166125784-166125806 TCTCCCCGATTCTTCCCTTGGGG + Intergenic
1018720972 6:166572576-166572598 TTTCCCTGCCTGTTGCCCTGTGG + Intronic
1018804678 6:167249516-167249538 TTTCCACGTTTATTTCCCTCTGG - Intergenic
1023901681 7:44486105-44486127 TTTCCTCCAGTGGTTCCCTGTGG - Intronic
1026800964 7:73399633-73399655 TTTCCCCGATTCTTCCCTTGGGG - Intergenic
1027608650 7:80331800-80331822 TTTCCATTATTGTGTCCCTGAGG + Intergenic
1028847586 7:95499616-95499638 TTTTACCAATTGTTTACCTGTGG - Intronic
1029020631 7:97361529-97361551 TTTACCTGATTTTTTCCCTGTGG - Intergenic
1029893165 7:103953159-103953181 TTGCCCTGATTTTTCCCCTGTGG - Intronic
1030193086 7:106829433-106829455 TTTCCCTGATTCTTCCCTTGGGG - Intergenic
1030837821 7:114310973-114310995 TCTCCCCGATTCTTCCCTTGGGG + Intronic
1031844025 7:126782581-126782603 TTTCACTGATAGTTTCCCTTTGG - Intronic
1034983194 7:155491269-155491291 TTTCCCCTTTTGTTTCTGTGGGG - Intronic
1035097307 7:156365901-156365923 TTTCCCCGCCAGTTTCACTGTGG + Intergenic
1035129617 7:156640303-156640325 GGGCCCCGGTTGTTTCCCTGCGG - Exonic
1036220624 8:6919319-6919341 TTTGCCAGCTTGTTTCCCTTGGG + Intergenic
1036625990 8:10471995-10472017 TTTCCCTGATTCTTCCCTTGGGG + Intergenic
1037692597 8:21194879-21194901 TCTCCCCGGTTGTTTACCCGAGG - Intergenic
1038236305 8:25760568-25760590 TGTCCTCTATTATTTCCCTGAGG - Intergenic
1040719616 8:50302361-50302383 TTTCCCCGATTATTTGCCACTGG + Intronic
1041138430 8:54787218-54787240 TTGCCTTGATTGTTTTCCTGAGG - Intergenic
1043082398 8:75783658-75783680 TTTGCCCGAGTTTTTACCTGTGG + Intergenic
1045409845 8:101905760-101905782 TTTCTCCAATTCTTTCCCTGTGG + Intronic
1056802951 9:89706766-89706788 TTTCCCCGAGATCTTCCCTGGGG - Intergenic
1057063858 9:92029768-92029790 TTTCCCCTAGTGGTTCCCTCAGG + Intergenic
1057973275 9:99577644-99577666 TTATCCAGATTTTTTCCCTGAGG - Intergenic
1185531905 X:828624-828646 TTACCCCAATTCTTTCCTTGTGG + Intergenic
1185835991 X:3346419-3346441 TTACCCCCAGTGTTTCCCTTGGG + Intronic
1188905747 X:35789254-35789276 CTTCCCTGATTCTTTCCTTGGGG + Intergenic
1190384293 X:49869570-49869592 TTTGGCTGATTGTTTCCCAGTGG + Intergenic
1190874412 X:54449486-54449508 TTTCCCCAATGATTTCTCTGTGG + Intronic
1190995059 X:55599102-55599124 TTTCCCCTATATTTTCCCTCTGG + Intergenic
1192336239 X:70222376-70222398 TTTCTCTGTTTGCTTCCCTGTGG + Intergenic
1192635723 X:72814882-72814904 TTTCACTGATTATTTTCCTGTGG + Intronic
1192645991 X:72905921-72905943 TTTCACTGATTATTTTCCTGTGG - Intronic
1194428350 X:93768241-93768263 TTTTACTGATTGTATCCCTGTGG + Intergenic
1197037937 X:121899633-121899655 TTTCCCTAAATGTTTCCCAGTGG - Intergenic
1201763591 Y:17561551-17561573 TATCCCCGCTTTTTTCCCCGGGG + Intergenic
1201837962 Y:18344439-18344461 TATCCCCGCTTTTTTCCCCGGGG - Intergenic