ID: 1181459817

View in Genome Browser
Species Human (GRCh38)
Location 22:23079288-23079310
Sequence GGCTCAGATGTCCCTTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181459817_1181459827 24 Left 1181459817 22:23079288-23079310 CCTAAGGAAGGGACATCTGAGCC No data
Right 1181459827 22:23079335-23079357 GCGAAGTCCACTTGGCTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 66
1181459817_1181459825 -1 Left 1181459817 22:23079288-23079310 CCTAAGGAAGGGACATCTGAGCC No data
Right 1181459825 22:23079310-23079332 CATTGGATGGGGAGAGGGCGCGG 0: 1
1: 0
2: 3
3: 29
4: 412
1181459817_1181459822 -7 Left 1181459817 22:23079288-23079310 CCTAAGGAAGGGACATCTGAGCC No data
Right 1181459822 22:23079304-23079326 CTGAGCCATTGGATGGGGAGAGG 0: 1
1: 0
2: 2
3: 31
4: 341
1181459817_1181459826 16 Left 1181459817 22:23079288-23079310 CCTAAGGAAGGGACATCTGAGCC No data
Right 1181459826 22:23079327-23079349 GCGCGGAAGCGAAGTCCACTTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1181459817_1181459823 -6 Left 1181459817 22:23079288-23079310 CCTAAGGAAGGGACATCTGAGCC No data
Right 1181459823 22:23079305-23079327 TGAGCCATTGGATGGGGAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181459817 Original CRISPR GGCTCAGATGTCCCTTCCTT AGG (reversed) Intronic
No off target data available for this crispr