ID: 1181462398

View in Genome Browser
Species Human (GRCh38)
Location 22:23093523-23093545
Sequence CTATGGAGGAGGAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 537}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181462398 Original CRISPR CTATGGAGGAGGAGGACAGA GGG Intronic
900123809 1:1060670-1060692 CCATCGAGGAGGAGGACAAAGGG + Intergenic
900560731 1:3304814-3304836 CTGAGGAGGAGGAGGCCACAGGG - Intronic
900638394 1:3676532-3676554 CTATGGAAGACGAGGCCAGAGGG + Intronic
900702422 1:4056516-4056538 CTATGGAGGAACACCACAGACGG - Intergenic
900776522 1:4589819-4589841 CTATTTAGGAGGAGGCCAGAGGG - Intergenic
900945875 1:5831105-5831127 CTGTGGAGGAAGAAGACTGATGG - Intergenic
902333397 1:15741845-15741867 CTAAGGCGGGGCAGGACAGATGG + Intergenic
903570087 1:24297818-24297840 CTTTGGAAAAGGATGACAGAGGG + Intergenic
903658597 1:24963683-24963705 CTAGGGAGGAGGAAGGCAGCAGG + Intronic
903832051 1:26181306-26181328 ATATGGTGGAGCAGGGCAGAGGG + Intronic
903954915 1:27018744-27018766 TTATGTAGGAGGAGGAGGGAAGG - Intergenic
904071558 1:27802497-27802519 AGATGGAGGAGGAGGGCAGGAGG + Intronic
904429549 1:30453225-30453247 CTATGGAAAAAGAGGACAAATGG + Intergenic
904440357 1:30525807-30525829 CCAGGGAGGGGGAGGAGAGAGGG + Intergenic
905319108 1:37103153-37103175 AGAAGGAGGAGGAGGAGAGAAGG + Intergenic
905319113 1:37103176-37103198 AGAAGGAGGAGGAGGAGAGAAGG + Intergenic
905337682 1:37256735-37256757 CGAGGGAGGGGGAGGAGAGATGG - Intergenic
905420874 1:37843122-37843144 CTATGGAAGATGAGGAGGGAGGG - Intronic
905628008 1:39501179-39501201 CCATGGAGGAGGGGGCCAGTGGG - Intronic
905999263 1:42409903-42409925 TTATGGACAAGGAGGCCAGATGG + Intronic
906216927 1:44047398-44047420 GGAGGGAGGAGGAGGACAGATGG + Intergenic
907221140 1:52907709-52907731 GGATGGAGGAGGATGACCGAGGG - Intronic
907467597 1:54649522-54649544 GGATGGAGGAGGAGGACTGGGGG + Intronic
907657820 1:56362318-56362340 TTAGGGAGGTGGAGGCCAGATGG - Intergenic
907701116 1:56789049-56789071 CTTTGGGGGAGGAGGACCCAGGG + Exonic
908197417 1:61758866-61758888 CTTTGGAGGCTGAGGCCAGAGGG - Intronic
908681729 1:66669334-66669356 ATTTGAAGGAGTAGGACAGAGGG + Intronic
910201702 1:84706654-84706676 CTCAGGAGAAGGAGCACAGAAGG - Intergenic
910212455 1:84807318-84807340 CTAGAGATGAGGAGGGCAGAGGG + Intergenic
911553905 1:99318926-99318948 CTATGGAAGGGGTTGACAGATGG - Intergenic
912599642 1:110915635-110915657 CCATGGAGGAGGAGAACAAGTGG + Intergenic
913389347 1:118293209-118293231 TCATGTACGAGGAGGACAGAGGG - Intergenic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
915473955 1:156141507-156141529 CTCTTGAGGAGGAGGGCTGAGGG + Intergenic
915479228 1:156173730-156173752 CTATGTAGGTGGAGGACACAAGG + Intronic
915664356 1:157431109-157431131 CTATTCAGGAGGAGGCCAGAGGG + Intergenic
915672962 1:157505610-157505632 CGATGGAGGAGGTTCACAGAAGG - Intergenic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
916160613 1:161909195-161909217 TTATGGAGCAAGAAGACAGAAGG - Intronic
916168889 1:161986057-161986079 TTATGGAGGAGGTGGGAAGAGGG + Intronic
916422131 1:164647292-164647314 CTAGGGAGGATGAGAAAAGAGGG + Intronic
916422156 1:164647459-164647481 TCATGGAGGAGGCTGACAGAAGG - Intronic
919810199 1:201404551-201404573 TTATGGAATAGGAGGACAGTAGG - Exonic
919830324 1:201536394-201536416 CTGTGGAGGAGGGGAACAGAGGG + Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
921157814 1:212452064-212452086 CCAGGGATGAGGAAGACAGAGGG - Intergenic
921266680 1:213426320-213426342 TTATGAAGGAGGAGAAAAGAAGG - Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
921666550 1:217879652-217879674 GTATGGAGGATGTGAACAGAGGG - Intergenic
922131991 1:222789014-222789036 CTATGTAAGAGGAGGAAATAGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922816611 1:228453680-228453702 TTATGGAGGAGGAAGAGAAAAGG - Intergenic
923189507 1:231606956-231606978 CTATAAAGGAGGAGGGCAGTGGG + Intronic
923381823 1:233428035-233428057 CTATGAAGAAGAAGGAAAGAGGG - Intergenic
923461924 1:234215374-234215396 CAATGGAGAAGGGGGGCAGAGGG + Intronic
1063105348 10:2987356-2987378 GAAGGGAGGAGGAGGAAAGAGGG - Intergenic
1063118898 10:3090684-3090706 CTATGGGGTAGGTGGACACAGGG - Intronic
1063204826 10:3820919-3820941 CCATGGAGGCAGAGGACAGCAGG - Intergenic
1063419152 10:5897392-5897414 CTGCGGAGGAGGTGGACACAGGG + Intronic
1064037601 10:11927196-11927218 CTATGGAGTTGGATGACATAAGG - Intronic
1064445972 10:15393232-15393254 ATCTGGGGGAGGAGGAGAGAAGG + Intergenic
1064804335 10:19113525-19113547 AAATGTAGGAGGAGGACAGAGGG - Intronic
1065250254 10:23803549-23803571 CTATGGGGCATGAGGACAGCAGG - Intronic
1065927736 10:30450639-30450661 CTCTGGAGAAGGAAGACGGACGG - Intronic
1066278817 10:33895140-33895162 ATATGCAGGAGGAGGACTGTGGG - Intergenic
1066304796 10:34129994-34130016 ATTTGGAAGAGTAGGACAGAAGG - Intronic
1066326155 10:34361101-34361123 CTGAGGAGGAGGAGCTCAGAAGG - Intronic
1067095766 10:43298661-43298683 CTGTGGAGGAGGAGGACATAGGG - Intergenic
1067252646 10:44600950-44600972 CCATGGAGGAGGAGGACGCTCGG - Intergenic
1067702526 10:48584001-48584023 GAATGAAGGAGGGGGACAGAAGG - Intronic
1067705104 10:48600881-48600903 CTCTGGAGAAGGAGGACCAAAGG - Intronic
1067759391 10:49032130-49032152 CTTTAGTGGAGGAAGACAGAAGG - Intronic
1068526979 10:58141798-58141820 CGATGGAGAAGGAAGAAAGAAGG + Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1069950426 10:72014774-72014796 GAAAGGAGGAGGAGGAGAGACGG - Intergenic
1070408889 10:76121187-76121209 CTATGGAGGAGAAGGTGATAGGG + Intronic
1070925816 10:80220852-80220874 CTATGGTGGGGGAGGAAGGAGGG - Intergenic
1070952794 10:80444403-80444425 GTTTGCAGGAGGAGGACTGATGG + Intergenic
1072445648 10:95496460-95496482 GGATGCAGGAGGAGGACAGCTGG - Intronic
1072543289 10:96414560-96414582 ATATGGAGAGAGAGGACAGAGGG - Intronic
1072839160 10:98751273-98751295 CTATGGAAGAGGAGCTTAGAGGG - Intronic
1073095325 10:100976069-100976091 TTATGGAGACGGGGGACAGATGG + Intronic
1073636154 10:105200847-105200869 CTATGGAGGTGGAGCAGAAACGG + Intronic
1074150166 10:110752178-110752200 ATATATAGGAGGAGCACAGAGGG - Intronic
1074605490 10:114960246-114960268 CTATGTAAAAAGAGGACAGAGGG + Intronic
1074845558 10:117394251-117394273 CTACGTAGTAGGAAGACAGAGGG - Intergenic
1075166268 10:120070927-120070949 TTATGAAGGAGGAAGGCAGAAGG + Intergenic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075806878 10:125195545-125195567 CTTGGGTGGGGGAGGACAGAGGG + Intergenic
1075822035 10:125322831-125322853 CGATGGTGGAGGTGGTCAGATGG + Intergenic
1075924511 10:126239969-126239991 GGATGGAGGAGGAGGGCAGGGGG - Intronic
1076658886 10:132042214-132042236 GAAAGGAGGAGGAGGAAAGAAGG - Intergenic
1076778145 10:132709426-132709448 AGAGGGAGGGGGAGGACAGAGGG + Intronic
1077026446 11:442021-442043 CGCTGGAGGAGGAGGAGGGAGGG - Intergenic
1077047632 11:553420-553442 CTGTGGAGGGGGCAGACAGAGGG + Intronic
1077274570 11:1697933-1697955 CTCTAGAGAAGGAGGACAGGAGG - Intergenic
1077483667 11:2828462-2828484 CTGGGAAGCAGGAGGACAGATGG + Intronic
1077607937 11:3624906-3624928 CTAAGGAGCAGGGGGACAGAGGG - Intergenic
1078026061 11:7696676-7696698 GTAAGGAGGAGGAGTACAAAGGG + Intronic
1078092698 11:8277147-8277169 CTATGGAGGAAAAGCACAGAGGG - Intergenic
1078528921 11:12121385-12121407 CTTTGGAGGAGGTGGTCAGCTGG - Intronic
1078848547 11:15143239-15143261 CTATGGAGGAGAAATACCGAGGG + Intronic
1079010104 11:16820904-16820926 CTATGGAGGAGGGACACAGGAGG + Intronic
1079023007 11:16924536-16924558 CAAAGGAGGAGGGGTACAGACGG + Intronic
1079360304 11:19765417-19765439 AGAAGGAGGAGGAGGAGAGAGGG - Intronic
1080209846 11:29772926-29772948 CAATGGAGCAGGAGGATAGAAGG - Intergenic
1080312928 11:30915080-30915102 TTATGAAGGTGGAGGAAAGAGGG + Intronic
1080539943 11:33256491-33256513 CTAGGGAAAAGGAGGAAAGATGG + Intergenic
1081245914 11:40765874-40765896 TTAAGGAGGAGGTGGAGAGATGG + Intronic
1081930554 11:46867978-46868000 CTCTGGAGGAGGTGGAAGGAAGG - Exonic
1082655820 11:55856083-55856105 CTCTGGAGCAGAATGACAGATGG - Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083811608 11:65109677-65109699 CCAAGGAGGCAGAGGACAGAGGG - Intronic
1084068728 11:66720314-66720336 GGATGGAGGAGGAAGCCAGACGG + Intronic
1084284967 11:68125090-68125112 TTATGGTGCAGAAGGACAGAAGG - Intergenic
1084321611 11:68376538-68376560 CTATGGAGGAAGGGCGCAGATGG + Intronic
1086179042 11:83927985-83928007 GTATGGAGGAGGAGCAAAGTGGG + Intronic
1086306286 11:85484241-85484263 CTAGGGAGGAGGAGGAGGGGCGG - Intronic
1086896553 11:92319891-92319913 GTAGGGATGAGGAAGACAGAGGG + Intergenic
1087408277 11:97756767-97756789 CTATAAAGTAGGAGGAAAGAGGG - Intergenic
1088441014 11:109870307-109870329 CTAGGGAGCGGGAGCACAGATGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1089200200 11:116720211-116720233 GCATGGAGGTGGAGGAAAGAAGG - Intergenic
1089883296 11:121795318-121795340 CAATGGAGCAGGAAGCCAGAGGG + Intergenic
1090715399 11:129426213-129426235 CTAGGAGAGAGGAGGACAGAGGG - Intronic
1090879021 11:130816994-130817016 CTATGGAGGAGGAGTACCAGTGG - Intergenic
1091130049 11:133138434-133138456 ATATGGAGGAGGAGGGCAATAGG - Intronic
1091136870 11:133199189-133199211 CTATGCAGGAGGTGGGGAGAGGG + Intronic
1091296007 11:134474428-134474450 GTGTGGAGGATGAGGAGAGACGG + Intergenic
1091447200 12:550892-550914 CAGTGGAGGAGGAGGAGTGAGGG - Intronic
1091635334 12:2192756-2192778 CTGTGGAGGAGGGGGAGAGTGGG - Intronic
1091933418 12:4415473-4415495 CCATGGACGACGAGCACAGAAGG + Intergenic
1092777795 12:11959438-11959460 GTATGAGGGAGGAGGACAGGCGG - Intergenic
1093418476 12:18947456-18947478 CAATGGAGATGGTGGACAGAGGG - Intergenic
1095963712 12:47852228-47852250 CTAGTGGGGAGTAGGACAGAGGG - Intronic
1096121460 12:49091861-49091883 CAAAGGAGGAGGAGGAAGGAAGG - Intronic
1096200231 12:49676157-49676179 CTAAGGAGGAGGAGGAGAAGAGG - Intronic
1096574247 12:52542958-52542980 TAATGGAAGAGGAAGACAGAGGG - Intergenic
1096581669 12:52589653-52589675 CTTTGATGGAGGAGGCCAGAAGG + Intronic
1097182152 12:57177723-57177745 CACAGGAGGAGGAGGACGGAGGG + Intronic
1097505378 12:60461349-60461371 CAATGGAAAAGGAAGACAGATGG - Intergenic
1098230227 12:68365517-68365539 CTGCGGAGGAGGAGGAAAGCTGG - Intergenic
1098392228 12:69981531-69981553 TGATGGAGGAGGAGGGCAGAAGG - Intergenic
1100246419 12:92762326-92762348 ATTTGGAGGTGGAGGAGAGAGGG + Intronic
1100583654 12:95959606-95959628 GTATGGGGGAGGAGGATAGTAGG - Intronic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1100891433 12:99130589-99130611 CTATAGAGGATGAGTAGAGAGGG - Intronic
1101038503 12:100729994-100730016 CTATGAATGAGGAGGAGAAAAGG - Intronic
1101467314 12:104961096-104961118 ATGTGGAGGAGGAGATCAGAAGG + Intergenic
1101539222 12:105649858-105649880 CAATGGAGGACTAGGACAGCTGG + Intergenic
1102764854 12:115423514-115423536 GGAGGGAGGAGGAGGACAAAGGG - Intergenic
1103172586 12:118834218-118834240 GTATGGAGGAGAAAGACAGAAGG + Intergenic
1103715868 12:122945037-122945059 CTGGGCATGAGGAGGACAGATGG - Intronic
1104159382 12:126163793-126163815 AGAAGGAGGAGGAGGAGAGAGGG + Intergenic
1104225785 12:126831930-126831952 AGAAGGAGGAGGAGGACAGAAGG - Intergenic
1104658662 12:130592919-130592941 GTATGGAAGATGAGGCCAGAAGG - Intronic
1105295821 13:19087388-19087410 CTCCAGAGGAGGAGGACAGATGG + Intergenic
1105548023 13:21365925-21365947 CGAGGGAGGAGGCAGACAGAGGG - Intergenic
1105812949 13:24010718-24010740 CCATGGAGGAGCAGGAGGGAGGG - Intronic
1106055228 13:26231082-26231104 CTGTGGAGGAAGAGGTCAAAAGG - Intergenic
1106758409 13:32844800-32844822 CAATGGAGGAGAAGAAAAGAGGG - Intergenic
1107611084 13:42113664-42113686 CGATGAAGGAGGTTGACAGATGG + Intronic
1107888552 13:44894443-44894465 CTATGGTGGAGGCAGAAAGAGGG - Intergenic
1109707108 13:66110490-66110512 CTAGGGAGGAGGAGAGCATAAGG - Intergenic
1111122713 13:83875754-83875776 CAATGGAAAAGGAGGAAAGAAGG - Intergenic
1112275975 13:98019829-98019851 CTGTGGAGGAGAAGGAAATAAGG - Intronic
1112694392 13:101931506-101931528 ACATGGTGGAGGAGGAGAGAGGG - Intronic
1113124137 13:106957749-106957771 CTATGGAGGAGGAGAAAATGGGG + Intergenic
1113649631 13:112026617-112026639 CTCTGCTGGAGGAGGACAGGTGG + Intergenic
1114943778 14:27651590-27651612 GTAAGGAGAAGGAAGACAGAAGG + Intergenic
1115307072 14:31944403-31944425 ATGAGGAGGAGGAGGAGAGATGG - Intergenic
1115884536 14:37956441-37956463 CTATGGGGGAGGAGCCAAGACGG - Intronic
1116991777 14:51285005-51285027 TTTTGGAGGAGGAAGACAGAAGG + Intergenic
1117065440 14:52009213-52009235 CTAAGGTGGAGGTGGCCAGAGGG + Exonic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118050420 14:62020537-62020559 CAAGGGAGGAGGGGGACAAAAGG + Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118429654 14:65703902-65703924 CTATGGAATATGAGGAAAGAGGG - Intronic
1118444152 14:65836808-65836830 ATTTGGTGGAGGAGGAAAGACGG + Intergenic
1118497788 14:66325875-66325897 CTTGGGAGGTGGAAGACAGAAGG + Intergenic
1119470071 14:74891035-74891057 GTCTGGAAGAGGAAGACAGATGG - Exonic
1119482009 14:74963710-74963732 CTAGGGAGCAGGAGGTCAGTGGG + Intergenic
1120735548 14:88047991-88048013 TTGTGGAAGAGGTGGACAGAGGG - Intergenic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1122265982 14:100547082-100547104 CTGTGGAGGAGCAGGAGTGAGGG - Intronic
1122426253 14:101607775-101607797 AAGTGGAGGAGGAGGAGAGATGG - Intergenic
1122454489 14:101839457-101839479 CTGTGGAGTAGGGGCACAGATGG - Intronic
1122549051 14:102540092-102540114 CTCTGGAGGAGGAGGCCGGATGG - Intergenic
1122699914 14:103581422-103581444 CTGTGGAGGTGCTGGACAGAGGG + Intronic
1122812028 14:104293825-104293847 CCTTGGAGGAGGAGGCCTGAGGG - Intergenic
1123538838 15:21266298-21266320 CTATAGACTAGGAAGACAGAAGG + Intergenic
1124155248 15:27219573-27219595 CTAAGGAGGGTGTGGACAGAGGG - Intronic
1124420212 15:29514616-29514638 CTACAGAGAAGGTGGACAGAGGG - Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1129907036 15:79195699-79195721 AAATGGAGGAGGAGGAAAGGAGG + Intergenic
1130578553 15:85115056-85115078 AAATGGAGGAGAAGGACTGAGGG + Intronic
1131048144 15:89329111-89329133 CTGAGGAGGAGGAGGAGAAAAGG + Intronic
1131223789 15:90607435-90607457 CTATGGAGGAGGGGGCCAGTCGG + Exonic
1131765269 15:95668877-95668899 CTTTGGAGTATGAGGAAAGAGGG + Intergenic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132120059 15:99168763-99168785 CAGTGGAGGAGGAGGAGAGGAGG - Intronic
1132859779 16:2064497-2064519 CACTCGAAGAGGAGGACAGAGGG - Intronic
1133260061 16:4543332-4543354 ATATGAAAGAGGAGGGCAGAGGG + Intergenic
1133440735 16:5818986-5819008 CAGAGGAGGAGAAGGACAGATGG - Intergenic
1133870028 16:9677452-9677474 CAGAGCAGGAGGAGGACAGAGGG + Intergenic
1134332725 16:13265303-13265325 AGATGGAAGAGGAGGGCAGAGGG - Intergenic
1134385048 16:13763917-13763939 GTCTGCAGGAGGAGGACAAAGGG + Intergenic
1134449526 16:14354514-14354536 AGAGGGAGGAGGAGGAGAGAGGG + Intergenic
1134876081 16:17700110-17700132 GAATGGAGGAGGAAGACTGATGG - Intergenic
1135007335 16:18838094-18838116 CTATGGTGGAGGTGGCCAGCAGG - Exonic
1135140399 16:19916347-19916369 GTATGGAGCAGAAAGACAGAAGG + Intergenic
1135464653 16:22674989-22675011 CAAGGGTGGAGAAGGACAGAAGG + Intergenic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1137475342 16:48803370-48803392 CTATGGAGGAAGAGGGAAGTGGG + Intergenic
1137673921 16:50294500-50294522 CTATGGAGGCTGAGGAAGGACGG + Intronic
1139431323 16:66912429-66912451 ATCTGGAGGAGGAGGAGGGATGG + Exonic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1141105573 16:81230667-81230689 CTGTGGAGGATTAGGAAAGAAGG - Intergenic
1141285820 16:82670568-82670590 CTATTGGGTAGAAGGACAGATGG + Intronic
1141431441 16:83972211-83972233 CCATGAAGCACGAGGACAGAAGG - Intronic
1141939296 16:87263950-87263972 CTAAGGATGAGGAACACAGAAGG + Intronic
1141941277 16:87277822-87277844 GCCTGGAGGAGGAGGACAGGCGG - Intronic
1142903261 17:3026442-3026464 CCATGGAGGAGGGCGACAGTGGG + Exonic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1145091241 17:19987865-19987887 CTATTGAGGAAGAGGTCAGAAGG - Intergenic
1146178148 17:30679698-30679720 CAGAGGAGGGGGAGGACAGAGGG + Intergenic
1146617233 17:34366686-34366708 CCATCCAGGAGGAGGAAAGAGGG - Intergenic
1147937547 17:44021637-44021659 CTCTTCAGGAGGAGGCCAGAGGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149748414 17:59122012-59122034 CTATAGAGCAGGAGGTCAGATGG + Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1150535787 17:66038877-66038899 CTATGGAGTAAGAGGAGACAGGG + Intronic
1151155471 17:72121101-72121123 CTTTGCAGGAGGAGAAGAGAAGG + Exonic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151775270 17:76196962-76196984 CTAGAGATGAGGAAGACAGATGG - Intronic
1152009258 17:77700857-77700879 AGATGGATGAGGAAGACAGAAGG - Intergenic
1152039541 17:77894117-77894139 CTGACGAGGAGGAGGAGAGAGGG - Intergenic
1152091925 17:78251977-78251999 AGATGGGGGAGGAGGACAGTGGG - Intergenic
1152251389 17:79214495-79214517 CCAGGGAGGAGGAGGAGAGATGG + Intronic
1203163098 17_GL000205v2_random:69615-69637 CTATTCAGGAGGAGGCCAGAGGG + Intergenic
1153242871 18:3046442-3046464 GTCTGCAGGAGGAGGGCAGAGGG + Intergenic
1153466317 18:5391590-5391612 CTCTGAAGGAGGGTGACAGAAGG - Intergenic
1153935791 18:9920126-9920148 AGATGGAGGAGGAGGACGTATGG + Intronic
1154031183 18:10755824-10755846 CAAGGGATGAGGAGGAGAGATGG + Intronic
1154031344 18:10756603-10756625 GGATGGAGGAGAAGGATAGATGG + Intronic
1154163158 18:11994944-11994966 TCATGAAGGAGGAGGACAGTGGG + Intronic
1155205854 18:23557287-23557309 TTAGGGAGGAGGAGGCCAGGAGG - Intronic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1155909829 18:31494804-31494826 CTATTCAGGAGGAGGCCAGAGGG + Intergenic
1157700236 18:49757680-49757702 CTCTGGATGAGCAGGACGGAGGG + Intergenic
1157826993 18:50821286-50821308 CTCTGGAGGAGGAAGAAAGATGG + Intronic
1158276079 18:55769009-55769031 CTAGGAAGGAGGAAGAAAGAAGG + Intergenic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1159537467 18:69733024-69733046 CCATGGTGGAGCAGGAGAGAGGG + Intronic
1160308014 18:77759371-77759393 CTTTGGAGGAGGAGGATGCAAGG + Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1161571433 19:5032843-5032865 CTGTGGAGGAAGACGAGAGAGGG - Intronic
1161625556 19:5324538-5324560 CAATGGAGGAGGAGAGGAGAAGG + Intronic
1162317009 19:9945654-9945676 CTCTGGGGGAGGAGGAGGGAAGG + Intergenic
1163076119 19:14893320-14893342 CTATGAAGAAGGAGGTTAGAAGG + Intergenic
1163216795 19:15885138-15885160 CTTTGGGGGAGGAAGAGAGAGGG - Intronic
1163804760 19:19388736-19388758 CTATGCAGGGGGAGGACTGAGGG - Intronic
1163855754 19:19700904-19700926 CTATTCAAGAGGAGGCCAGAAGG - Intergenic
1163871567 19:19825521-19825543 CTATTCAAGAGGAGGCCAGAGGG + Intergenic
1163885494 19:19961283-19961305 CTATTCAGGAGGAAGGCAGAGGG + Intergenic
1163897095 19:20068771-20068793 CTATACAGGAGGAAGCCAGAGGG + Intergenic
1163949250 19:20568771-20568793 CTATTCAGGAGGAGACCAGAGGG + Intronic
1163968850 19:20773292-20773314 CTATTCAGGAGGAGGCCAGAGGG - Intronic
1165291948 19:34892921-34892943 TGATGGAAGAGGAGCACAGAGGG - Intergenic
1165330916 19:35140906-35140928 ACAGGGAGGAGGAGGACAGGGGG - Intronic
1165351117 19:35276535-35276557 CTCTGGAGGAGGAGGAGATGCGG + Intronic
1166134989 19:40770859-40770881 ATATGGAGGAAGAGTACAAAGGG + Intergenic
1167101380 19:47406260-47406282 ACATGGAGGAGGAGGATGGATGG + Intronic
1167236417 19:48318665-48318687 CTGGGGAGGAGGGGGTCAGAGGG - Intronic
1167619187 19:50551653-50551675 AGATGGAGGAGAAGGAGAGAAGG - Intronic
1167691919 19:50990655-50990677 CTAAGGAGGCAGAGGACTGAGGG - Intergenic
925426569 2:3753615-3753637 TTATGGTGGAGCAGGACAGATGG + Intronic
927975927 2:27338192-27338214 CGATGGAGGAGTAGAGCAGAAGG - Intronic
927982826 2:27385237-27385259 CTGTGGAGGAGGAGGAGCTAGGG - Intronic
928236509 2:29546521-29546543 TGCTGGAGGAGGAGGACGGAAGG + Intronic
928460749 2:31470204-31470226 TTGTGGAGGTGGAAGACAGACGG - Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929509577 2:42556226-42556248 CTCTGGAGTAGGAGTACAGGAGG - Intronic
929592183 2:43154582-43154604 GAAAGGTGGAGGAGGACAGATGG + Intergenic
929944670 2:46361438-46361460 CTCTGAAGCAGGAGTACAGATGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
931123359 2:59245688-59245710 TGATGGCGGAGGAGGAGAGAAGG - Intergenic
932097183 2:68861429-68861451 CTATGGAAGAGAAGTACACAGGG - Intergenic
932443023 2:71749846-71749868 CCATGGAGGATGAAGACTGAGGG + Intergenic
932696877 2:73964501-73964523 CTATGGAAGAGGAGGAGAGGTGG - Intergenic
933232827 2:79829178-79829200 CTCTGTAGGAGGAATACAGAAGG + Intronic
934546538 2:95221928-95221950 ATAGGGAGGAGGAAGAGAGAGGG - Intronic
934680186 2:96278101-96278123 GTATGGAGCGGGAGGACATATGG + Intronic
935381042 2:102451440-102451462 CTGAGGAGGAGGAGGCCAGCAGG - Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936089747 2:109493894-109493916 AAGTGGAGGAGGAGGAGAGAAGG - Intronic
936487937 2:112942648-112942670 CTCTGGAGGAGGAGGAGCAAGGG - Intergenic
937734153 2:125269627-125269649 AGAAGGAGGAGGAGGACAAAAGG - Intergenic
938174051 2:129108021-129108043 CTATCTTGGAGGAGCACAGAAGG - Intergenic
938287605 2:130130310-130130332 GTAACGAGGAGGAGGAAAGAGGG + Intergenic
938427989 2:131208549-131208571 GTAACGAGGAGGAGGAAAGAGGG - Intronic
938468899 2:131542561-131542583 GTAACGAGGAGGAGGAAAGAGGG - Intergenic
938677909 2:133657484-133657506 CTAAGGAACAGGAGGAGAGAAGG - Intergenic
939914446 2:148021572-148021594 CGAAGGAGGAGGAGGAGAGCTGG - Intronic
940468946 2:154068219-154068241 CTGGGGAGGATGAGGACAAAAGG + Intronic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941882213 2:170492658-170492680 CCATGGAGAAGGAGTAAAGAGGG - Intronic
943718509 2:191178527-191178549 CTAAAGAAGAGGAGGAAAGAAGG - Intergenic
944690356 2:202153254-202153276 GTCTAGAGGAGGAGGAGAGATGG + Intronic
945507577 2:210660127-210660149 CAATGAAGCAAGAGGACAGAAGG + Intronic
946371298 2:219283098-219283120 CAAGGGAGGAGGAGGAGAGGTGG - Intronic
946412410 2:219521945-219521967 GAAGGCAGGAGGAGGACAGAGGG + Intronic
947134948 2:226968042-226968064 TTATGCAAGAGCAGGACAGAGGG - Intronic
948544521 2:238717343-238717365 CTCTGGATGGGAAGGACAGACGG + Intergenic
948855620 2:240729242-240729264 CTTTGGAGGCAGAAGACAGAGGG - Intronic
1168924127 20:1565863-1565885 CCATGGAAAAGGTGGACAGAGGG - Intronic
1169045537 20:2531871-2531893 AGAAGGAGGAGGAGGAGAGAAGG + Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170626367 20:18033234-18033256 CGATGGAAGATAAGGACAGAAGG + Intronic
1173115980 20:40243330-40243352 ATATGGAGGTGGAGGAATGAAGG - Intergenic
1173146224 20:40526788-40526810 CCCTGGAGGAAGAGAACAGAAGG + Intergenic
1173336810 20:42118764-42118786 CTGAGCAGGAGGAGGACAGAAGG - Intronic
1173687810 20:44936522-44936544 CACTGGAGGAGGGGAACAGAGGG - Intronic
1173887219 20:46470279-46470301 CAAAGTAGGAGGAGGAAAGATGG - Intergenic
1174184837 20:48699060-48699082 CTCTAGAGGAGGAGGACAGTGGG + Intronic
1174439490 20:50538814-50538836 CTCTGGAGGAGGGTGAAAGAAGG - Intronic
1174732074 20:52927721-52927743 CCATGGAGGATGCGGAAAGAAGG - Intergenic
1174767315 20:53266159-53266181 CAAGGGTGGAGGAGGACACAGGG + Intronic
1174890385 20:54385412-54385434 CTGTGGAGGACAAGGACAGGAGG + Intergenic
1175720742 20:61285462-61285484 GTATGGAGAAGAAGGAAAGAGGG + Intronic
1176103456 20:63375018-63375040 CTAGGGAGGAGGTGGGCAGGTGG + Intronic
1176108654 20:63401228-63401250 CAACGGTGGAGGAGGAGAGACGG - Intergenic
1176549358 21:8214663-8214685 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176557251 21:8258886-8258908 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176576193 21:8441921-8441943 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176728142 21:10460881-10460903 CTATGGGGGATTAGGAAAGAAGG + Intergenic
1176855548 21:13966601-13966623 CTGAGGAGGAAGAGGACAGGTGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178708996 21:34897698-34897720 TTATGGTGGAGGAGGAATGAGGG - Intronic
1179546005 21:42112620-42112642 CTATGGAGGTGCAGAACAGTGGG - Intronic
1179553840 21:42160204-42160226 GGATGGAGCAGGAGGGCAGAGGG - Intergenic
1180800621 22:18630268-18630290 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1180834388 22:18922644-18922666 GTGGGGAGGAGGAGGTCAGAGGG - Intronic
1180851853 22:19025825-19025847 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1181221098 22:21364994-21365016 CTTTGGAGGAGGAGGAAGGGTGG + Intergenic
1181264466 22:21622746-21622768 CTCTGGAGGAGGGGGTCAGCAGG - Exonic
1181462398 22:23093523-23093545 CTATGGAGGAGGAGGACAGAGGG + Intronic
1183016981 22:34996837-34996859 CTATGAAGGAGTATGGCAGAGGG + Intergenic
1183197296 22:36362261-36362283 CTATGGAGTAGGAGATCAGAGGG - Intronic
1183459598 22:37941808-37941830 CTATGGGAGAGGAGGAGTGATGG + Exonic
1183509542 22:38226895-38226917 GTGTGGAGGAGGAGCACAGAAGG + Intronic
1183526737 22:38327564-38327586 GAGTGGAGCAGGAGGACAGAGGG - Intronic
1183782083 22:40005560-40005582 CTCCAGAGGAGGAAGACAGATGG - Intronic
1184047884 22:41982987-41983009 TGAAGGAGGAAGAGGACAGAAGG - Intronic
1185131985 22:49044528-49044550 GAATGGGGGAGGAGAACAGATGG - Intergenic
1185149595 22:49156429-49156451 CTCTGGAGGAGGAGGACGAGGGG - Intergenic
1203254243 22_KI270733v1_random:130979-131001 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203262299 22_KI270733v1_random:176058-176080 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203284477 22_KI270734v1_random:147943-147965 GTGGGGAGGAGGAGGTCAGAGGG - Intergenic
949396903 3:3624271-3624293 TTATGGAGGAGGTGGGCAGTGGG - Intergenic
949409593 3:3749262-3749284 CCATGGAGAAAGAGGAAAGAAGG + Intronic
949952957 3:9244358-9244380 GTATGGAGGATGACCACAGAGGG - Intronic
949969911 3:9396432-9396454 CGGTGGAGGAGGTGGAGAGAAGG - Intergenic
952256087 3:31696960-31696982 TTATGGAGGAGGAGGAGACTAGG - Intronic
952497249 3:33926639-33926661 CTATGGAAGAGGAGGGGAGTGGG - Intergenic
952767755 3:36969704-36969726 GGGTGGAGGAGGAGGAGAGAAGG + Intergenic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954151153 3:48657764-48657786 CTATGCTGGAGGAGGGGAGAAGG - Intronic
954213530 3:49111633-49111655 CTATGGCTGAGGGGGACACAGGG - Exonic
954226229 3:49182984-49183006 GTATGGAGGGAGAGGCCAGAGGG - Intronic
954588878 3:51762926-51762948 CTGTGGAGGAAAAGGAGAGAAGG - Intergenic
954876430 3:53805824-53805846 AGATGGAGGAGGAGGGAAGATGG - Intronic
954876435 3:53805841-53805863 TGAGGGAGGAGGAGGAAAGATGG - Intronic
955349308 3:58182235-58182257 AGAAGGAGAAGGAGGACAGAAGG + Intergenic
955494088 3:59512988-59513010 CTCTGGAGCAGGTGGACCGAGGG + Intergenic
956874020 3:73444352-73444374 GAAAGGAGTAGGAGGACAGATGG - Intronic
957002900 3:74907504-74907526 CTAGGGAGGAGGAGGGCAGGAGG - Intergenic
961484810 3:127209271-127209293 TTATGCAGGAGAAGGCCAGAGGG + Intergenic
962499621 3:135977218-135977240 CTTTGGAGTGGGAGGACAAAGGG - Intronic
962908399 3:139825758-139825780 CTATGGAGGGTGAAGAGAGAGGG + Intergenic
965440648 3:168709243-168709265 ATCTAGAGGAGGAAGACAGATGG - Intergenic
966073948 3:175913203-175913225 ATATGAAGAAGGAGGCCAGAAGG + Intergenic
966744935 3:183266515-183266537 GTATGGTGGAGGAGGCCAGAGGG + Intronic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967920156 3:194608535-194608557 AAATAGAGGAGAAGGACAGACGG + Intronic
968035308 3:195543352-195543374 CTAGGGAGGAGGCGGGGAGAGGG + Exonic
968127159 3:196168461-196168483 CTTTGCAGGAGGAGCACATATGG + Intergenic
968417552 4:453230-453252 CTATTTAGGAGGAGGCCAGAGGG + Intronic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
968801819 4:2747824-2747846 CTACGGAGGAGCATGGCAGAAGG - Exonic
969512205 4:7624903-7624925 TCATGGAGGAGGAGGACGGCGGG + Intronic
969515804 4:7647677-7647699 ATATGGACGAGGAGGGCAGGGGG + Intronic
969600688 4:8174235-8174257 TTATGGAGGAGGAGCAGCGAGGG - Intergenic
970077521 4:12241288-12241310 TCATGGAGGAGGGTGACAGATGG + Intergenic
971002434 4:22338206-22338228 CTATTCAGGAGGAGGCCAGAGGG - Intergenic
971646318 4:29209239-29209261 AGAAGGAGGAGGAGGGCAGAAGG - Intergenic
972158060 4:36189548-36189570 GTAGGGAGAAGGAGGACATAGGG - Intronic
972810852 4:42584264-42584286 GAATGGAGGAGGAGAAAAGAGGG + Intronic
973260482 4:48158788-48158810 CTCAGAAGGAGGAGGAAAGAAGG + Intronic
973645134 4:52942718-52942740 CTCAGGAGGAGAAGTACAGAAGG + Intronic
973808239 4:54546028-54546050 CAATGGAGGAGAAGGTCACAAGG - Intergenic
977758314 4:100700235-100700257 CTGGGCTGGAGGAGGACAGATGG - Intronic
977861701 4:101968775-101968797 TTATGCAGGAGGTGGAGAGAGGG + Intronic
979455001 4:120917131-120917153 CAGTTGAGGAGGAGGTCAGAGGG - Intronic
979678062 4:123431138-123431160 TTTTGTAGGAAGAGGACAGAAGG - Intergenic
982334273 4:154215981-154216003 CTATGGCGGAGGAGGAAAAGAGG - Intergenic
983661804 4:170136527-170136549 CTATGGAACATGAAGACAGAGGG - Intergenic
983690991 4:170469018-170469040 TTGTGGAGGAGGAAGATAGATGG - Intergenic
983833476 4:172360645-172360667 CTATGTAGGATGAGAAAAGAGGG + Intronic
984581142 4:181511422-181511444 GCCTGGAGGAGGAGGACAGAAGG + Intergenic
984724713 4:183009668-183009690 CTAAGGAGCTGGAGGACAAAAGG + Intergenic
984873789 4:184349858-184349880 CAGTGGAGGATGAGGACAGGGGG + Intergenic
985955485 5:3262574-3262596 CTATGGAGGAGAAGCACAGGAGG + Intergenic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988000097 5:25336681-25336703 CAAGTGAGGAGGAGGAGAGATGG - Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989656378 5:43749328-43749350 CTATGGGGGAGGAGCCAAGATGG - Intergenic
990073215 5:51810594-51810616 CTCAGGAGAATGAGGACAGAAGG - Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
993532546 5:89042141-89042163 CTGTGCAGGAGGTGGGCAGATGG + Intergenic
994313874 5:98309489-98309511 ATATGGAGGTGGATGATAGATGG - Intergenic
994815117 5:104576217-104576239 AGAGGGAGGAGGGGGACAGAGGG - Intergenic
995072439 5:107940359-107940381 TTTTGGAGGAGGGGGACACATGG + Intronic
995444016 5:112222859-112222881 CTTTGGAGCAGGAGTCCAGAAGG - Intronic
995754343 5:115486679-115486701 AAAAAGAGGAGGAGGACAGAGGG - Intergenic
996343754 5:122467597-122467619 AGAAGGAGGAGGAGGAAAGAAGG + Intergenic
996759675 5:126974432-126974454 ATATGGAGGAGAAGAGCAGAGGG - Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997389810 5:133504822-133504844 CTATGAAGGAAAAGAACAGAGGG - Intronic
998590974 5:143477912-143477934 GTAGGGAGGAGGAGGAAAGAGGG - Intergenic
998815891 5:146013818-146013840 CTCTGGAGGACGAGGACACCAGG - Exonic
999361078 5:150987277-150987299 GTGTGGAGGAGGAGGAAATAGGG + Intergenic
1001798755 5:174525405-174525427 CTAGGGAAGAGGATTACAGATGG + Intergenic
1001890968 5:175338206-175338228 ATAAGAAGGAGGAGGAGAGAGGG - Intergenic
1003493399 6:6642859-6642881 CTCCGGAGGAGGAGGAGGGAGGG - Intronic
1003810065 6:9769454-9769476 CTATGGAGAAGGCAGAGAGAAGG + Intronic
1004064264 6:12227522-12227544 CTAAGGAGGAGGAAGAAAGGGGG + Intergenic
1004420917 6:15469156-15469178 GTGTGGAGGAGGAGGATAAAAGG + Intronic
1005271088 6:24164404-24164426 CTATGGAGGAGGGGATCAAAAGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1006149711 6:31980381-31980403 TAATGGATGAGGAGGAGAGATGG + Intronic
1006165184 6:32060375-32060397 CGATAGAGGAGTAGGACAGATGG + Intronic
1007287957 6:40761791-40761813 CTATGGGTGAACAGGACAGAGGG + Intergenic
1007835128 6:44668145-44668167 TTATGGAGGCAGAGGAAAGAAGG - Intergenic
1008167865 6:48162613-48162635 GCATTGAGGAGGAGGGCAGAGGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1009714513 6:67372256-67372278 TTTTGGGGGAGGAGGACATATGG + Intergenic
1010478065 6:76313977-76313999 CAAAGGAGGAGGAGGATAAAGGG + Intergenic
1011390938 6:86852610-86852632 CTAATAAGGAGGAGGAAAGAAGG + Intergenic
1013837023 6:114344597-114344619 ATATTGAGCAGGAGGAAAGATGG + Intergenic
1014422984 6:121267772-121267794 CACTTGAGGAGGAGGAGAGAGGG - Intronic
1015104960 6:129525358-129525380 AGATGGAGATGGAGGACAGAAGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016207080 6:141481569-141481591 AAATGAAGGAGGAAGACAGAAGG - Intergenic
1017252578 6:152297151-152297173 CATTGGAGGAGGAGGAGAGGGGG - Intronic
1017405617 6:154115583-154115605 CAATGGAGGTAGAGGAGAGAAGG - Intronic
1018066722 6:160129727-160129749 CTAAGGAGGAGGAGGAAAAGAGG + Intronic
1018425510 6:163676730-163676752 CCAGGGAGGAGGACTACAGATGG + Intergenic
1018577098 6:165270514-165270536 AGATGGAGAAGGAGGAGAGAAGG + Intergenic
1018616150 6:165688791-165688813 GAAGGGAGGAGGAGGAGAGAGGG - Intronic
1018735724 6:166685942-166685964 CTAGGAGGGAGGGGGACAGAGGG + Intronic
1019122404 6:169813713-169813735 TTCTGGAGGCTGAGGACAGAAGG + Intergenic
1019328477 7:451226-451248 AGATGGAGGAAGAGGAGAGACGG - Intergenic
1019972121 7:4549669-4549691 ATAGGGAGGAGGAGGAGAGAAGG + Intergenic
1020136665 7:5591842-5591864 CTTTGGGGGAGGAGGATGGAGGG + Intergenic
1020583892 7:10040751-10040773 AGATGGAGGAGGAGGAGAAAGGG + Intergenic
1022174547 7:27860914-27860936 TTCTGGAGTAGAAGGACAGAGGG - Intronic
1023107274 7:36774809-36774831 TCATGGAGTAGGAGGACAGAAGG - Intergenic
1023503407 7:40874907-40874929 CCATGGAGCAGGCAGACAGATGG - Intergenic
1023537143 7:41225556-41225578 AGATGAAGGAGGAAGACAGAGGG + Intergenic
1023736058 7:43237057-43237079 CTAGGGAGGAGAAGGAGGGAGGG + Intronic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024045486 7:45582759-45582781 ACATGGGGTAGGAGGACAGATGG - Intronic
1026214440 7:68335782-68335804 AGAGGGAGGAGAAGGACAGAGGG + Intergenic
1026493203 7:70880968-70880990 CTATGAAGGAAGAGGACAGAAGG + Intergenic
1026536790 7:71245154-71245176 GGATGGAGGACGAGGGCAGATGG - Intronic
1027217911 7:76196040-76196062 CTGGGGAGGGGGAGGACACAGGG + Intergenic
1027900666 7:84110261-84110283 CTAGGGAGCAGGAGGAAGGAAGG - Intronic
1028214787 7:88118151-88118173 CTATGGTAGAGAAGCACAGAGGG + Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1030342885 7:108400802-108400824 CTAGGGAGGAGAAAGCCAGATGG + Intronic
1030675830 7:112384502-112384524 GTAGGGAAGAGGAGGACAGAAGG - Intergenic
1030734969 7:113037333-113037355 AAAGGGAGAAGGAGGACAGAGGG + Intergenic
1030932071 7:115536921-115536943 CTATAGAGGAAGACCACAGACGG + Intergenic
1031107616 7:117564991-117565013 TTATGAAAGAGGAGGACTGAAGG - Intronic
1033305786 7:140224326-140224348 CGTTGGAGGAGGAGGCCAGAGGG + Intergenic
1033978405 7:147131490-147131512 CCAAGGAGGAGGAGTATAGAAGG + Intronic
1034601954 7:152267149-152267171 CTATGGGGGATTAGGAAAGAAGG - Intronic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1036148820 8:6279527-6279549 CTTTGGAGGAGGAGCACAGACGG - Intergenic
1037193752 8:16160830-16160852 CTAGGCAGAAGGATGACAGAGGG + Intronic
1038425818 8:27463174-27463196 TGGTGGAGGAGGAGGACAGATGG - Exonic
1038483694 8:27918990-27919012 GAAGGGAGGAGGAGGAGAGAAGG + Intronic
1038483699 8:27919008-27919030 GAAGGGAGGAGGAGGAGAGAAGG + Intronic
1038483704 8:27919026-27919048 GAAGGGAGGAGGAGGAGAGAAGG + Intronic
1038483709 8:27919044-27919066 GAAGGGAGGAGGAGGAGAGAAGG + Intronic
1038483714 8:27919062-27919084 GAAGGGAGGAGGAGGAGAGAAGG + Intronic
1038751896 8:30303809-30303831 TCATGGAGGAAGAGGACAAATGG + Intergenic
1039043476 8:33429571-33429593 CAATTGAGGGGGAGGGCAGATGG + Intronic
1040679605 8:49792679-49792701 CTGTGGAGGAGGTGCTCAGAAGG - Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042149478 8:65766655-65766677 TAATGGAGGAAGAGGAGAGAGGG - Intronic
1042244039 8:66693178-66693200 CCATGGAGGAGGCAGACAGCTGG - Intronic
1043330263 8:79108123-79108145 ATATGGAAGAGGCAGACAGATGG - Intergenic
1043435194 8:80231276-80231298 TTAAGGAGGGGGAGGACAAAGGG - Intergenic
1043493891 8:80779137-80779159 GGAAGGAGGAGGAGGAAAGAAGG - Intronic
1043494392 8:80784061-80784083 ATATGGAGTATGAGGACAGAGGG - Intronic
1045900315 8:107271060-107271082 GTGTGGAGGAGGAGGAAAAAAGG - Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1048194758 8:132323172-132323194 CCTTGGAGGAAGAAGACAGAGGG - Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048457064 8:134587782-134587804 CTATGGAGAAGGAATTCAGAAGG - Intronic
1049113991 8:140670066-140670088 GAAAGGAGGAGGAGGACATATGG + Intronic
1049207502 8:141370331-141370353 CTATGGAGGAGGGGCAGAGGGGG + Intergenic
1049321302 8:141997973-141997995 CTGTGGAGGATGTGGACCGAGGG - Intergenic
1049324572 8:142015295-142015317 CTGAGGAGGAGCAGGACACATGG + Intergenic
1049341482 8:142114872-142114894 GGGAGGAGGAGGAGGACAGAGGG + Intergenic
1049563623 8:143325827-143325849 CCATGGAGGAGGAGGGCTAAGGG + Intronic
1050114387 9:2248608-2248630 CTATGGATCAGGAGAAAAGAGGG - Intergenic
1050610437 9:7346867-7346889 GGATGGAGGAGGAGGATGGAAGG - Intergenic
1050621215 9:7453862-7453884 CTATGGCAGACGAGGACAAACGG - Intergenic
1051132986 9:13883420-13883442 AAATGATGGAGGAGGACAGATGG + Intergenic
1051451818 9:17205620-17205642 CTATTCAGGAGGAGGCCAGAGGG + Intronic
1053017269 9:34669438-34669460 CCATGGAGGATGAGCAGAGATGG + Intergenic
1053175231 9:35917706-35917728 CTCAGGAGGACAAGGACAGAGGG - Intergenic
1053383758 9:37670385-37670407 GTATGAGGGAGGAGGACAGCAGG + Intronic
1054882210 9:70155742-70155764 CATTGGAGGAGGAAGGCAGAGGG - Intronic
1054898926 9:70346689-70346711 CTAGGGAGGAGCAAGGCAGAGGG - Intronic
1055986657 9:82060998-82061020 TTTTGGAGGAGGAGGAGAGCAGG + Intergenic
1056104855 9:83336965-83336987 CTATGGAGGCTGTGCACAGAGGG + Intronic
1056373466 9:85983121-85983143 CTCTGGAGGAGGGGGACAGAGGG + Intronic
1057815798 9:98293278-98293300 CTTTGGAGGAAAAGCACAGAAGG - Intronic
1058467321 9:105242735-105242757 CTATAAAGAAGGAAGACAGATGG + Intergenic
1059477020 9:114555408-114555430 CTATTAAGGTGCAGGACAGATGG + Intergenic
1060134596 9:121140618-121140640 CTATGGAGGGGGATGAAATAGGG - Intronic
1060159132 9:121344019-121344041 CTAGGTAGGAGGAGGAAAGGGGG + Intronic
1060427442 9:123518495-123518517 GTAGGGAGGAGTAGGACAGCTGG - Intronic
1060624830 9:125102415-125102437 TTATGAAAGAGGAGGACTGAGGG - Intronic
1060712495 9:125882120-125882142 CTATGGAGGATGAGGTGGGAGGG + Intronic
1060764403 9:126283050-126283072 CAATGGGGGAAGAGGTCAGAGGG + Intergenic
1061316807 9:129801572-129801594 CTATGGGGGAGGCCGACAAAGGG - Intergenic
1061681078 9:132242660-132242682 GTCTGGGGGAGGAGGAGAGAAGG + Exonic
1062127467 9:134871345-134871367 CTGTCGAGAAGGAGGACACAGGG - Intergenic
1062208604 9:135350887-135350909 ATCTGGAGGTGGAGGACAGTGGG + Intergenic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062514007 9:136922963-136922985 CGGTGGAGGACGAGGACGGAAGG + Intronic
1203761564 EBV:15001-15023 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203762493 EBV:18073-18095 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203763422 EBV:21145-21167 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203764351 EBV:24217-24239 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203765280 EBV:27289-27311 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203766209 EBV:30361-30383 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203767138 EBV:33433-33455 CTCTGGAGGACGGGGACGGAGGG - Intergenic
1203470644 Un_GL000220v1:114123-114145 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203478465 Un_GL000220v1:158095-158117 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1185550645 X:980724-980746 CCATGGAGGAGGAGGAGGGGCGG + Intergenic
1185550654 X:980750-980772 CCATGGAGGAGGAGGAGGGGCGG + Intergenic
1185966300 X:4607770-4607792 CCATGGCGGAGCAGGAGAGAAGG - Intergenic
1185980649 X:4774420-4774442 CTATTCAGGAGGAGGCCAGGGGG - Intergenic
1186532521 X:10311551-10311573 GGGAGGAGGAGGAGGACAGAAGG - Intergenic
1189050543 X:37640833-37640855 CTATGGCTGAAGAGGAGAGAAGG - Intronic
1189179500 X:38989845-38989867 TTGTGGAGGAGGAGGATATAAGG + Intergenic
1189673104 X:43433223-43433245 CCATGGTGGAGGAGCAGAGAGGG + Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1191668239 X:63725120-63725142 CCAAGGAGGAGGAGGAAAGGGGG - Intronic
1192212899 X:69138986-69139008 TTATGAAGGAGGAGGACATGAGG - Intergenic
1192589404 X:72347346-72347368 GTAAGGAGGAGGAGGAGGGAAGG - Intronic
1192873162 X:75204287-75204309 ATGTGGAGGAGGAGGAAATAGGG + Intergenic
1193096789 X:77557919-77557941 CTCTGTAGGAGGAGGACAGCAGG + Intronic
1194637606 X:96364551-96364573 CGAAAGAGGAGGAGGAGAGAGGG - Intergenic
1195151849 X:102079514-102079536 GGATGGAGGAGCAGCACAGACGG + Intergenic
1195364936 X:104116483-104116505 CTATGTAGGTGGAGGACAGGAGG + Intronic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196866995 X:120078953-120078975 CTATGCAGCAGCAGGAAAGAAGG - Intergenic
1196876104 X:120157329-120157351 CTATGCAGCAGCAGGAAAGAAGG + Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197515606 X:127423973-127423995 CTGAGGAGGAGGAGGACAGAGGG - Intergenic
1197906065 X:131427217-131427239 AGAAGGAGGAGGAGGAGAGAAGG - Intergenic
1197906069 X:131427234-131427256 AGAAGGAGGAGGAGGAGAGAAGG - Intergenic
1197906089 X:131427315-131427337 AAAAGGAGGAGGAGGAGAGAAGG - Intergenic
1198546260 X:137695740-137695762 TTATAGAGAAGGAGGGCAGAGGG - Intergenic
1199580061 X:149351850-149351872 AGATGGATGAGGAGGCCAGAAGG + Intergenic
1200080008 X:153571648-153571670 GTGGGGAGGAGGGGGACAGATGG - Intronic
1200270787 X:154680716-154680738 CTTGGGAGGAGAAGGAAAGATGG - Intronic
1200317218 X:155146779-155146801 ATATGTAGGATGAGGACAGCTGG - Intronic