ID: 1181462443

View in Genome Browser
Species Human (GRCh38)
Location 22:23093805-23093827
Sequence TCTGGCTGTCAGAGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181462438_1181462443 4 Left 1181462438 22:23093778-23093800 CCAAGGGAAAGAGGCGGCATTAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG 0: 1
1: 0
2: 6
3: 45
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181462443 Original CRISPR TCTGGCTGTCAGAGGCTGGC AGG Intronic
900250106 1:1664460-1664482 TCTGGGTCTCAAAGGCTGGCTGG + Exonic
900261137 1:1730366-1730388 TCTGGGTCTCAAAGGCTGGCTGG + Intronic
900614262 1:3557543-3557565 TCTGGCTACCGCAGGCTGGCAGG - Intronic
901086319 1:6614155-6614177 TCTGGCTGCCTGAGGACGGCAGG - Intronic
901158491 1:7156428-7156450 TCTGGCCCTCAGAGGCCAGCTGG - Intronic
901678678 1:10901133-10901155 TCCGGGTGCCAGAGGCGGGCAGG + Intergenic
901787763 1:11635992-11636014 TCTGGGTCTCAGAGGCTGGCAGG + Intergenic
902735515 1:18398212-18398234 TCTGCGTGTCTTAGGCTGGCGGG + Intergenic
902838683 1:19062055-19062077 TGTGGCTGGGAGAGGCTGGGAGG - Intergenic
903229282 1:21911978-21912000 TCTGAGTGTCAGAGGCAGCCTGG + Intronic
903326977 1:22574479-22574501 GCTGGCTGCCAGGGGCTGGCAGG - Intronic
903414175 1:23170082-23170104 TCTGGCTGGGAGAAGCTGGGAGG - Intronic
904228890 1:29050184-29050206 TCTGGCTGTGAAAGGCTGCGTGG - Intronic
905702182 1:40025802-40025824 CCTGGCTGACTGAGGCTGGAAGG - Intergenic
906318515 1:44803043-44803065 GCAGGCAGTGAGAGGCTGGCAGG - Exonic
906476370 1:46172027-46172049 AGTGGCTGCCTGAGGCTGGCTGG + Intronic
906960721 1:50418287-50418309 TCCGGCTCTCAGTGGATGGCAGG - Exonic
907496639 1:54849713-54849735 TGTGGCTGTAAGAGCCTGACAGG + Exonic
907813777 1:57898249-57898271 TCTGCCAGACAGAGGCTGACTGG + Intronic
908829944 1:68168768-68168790 TATGTCTGCCAGAGGCTGGGAGG - Intronic
912491255 1:110064008-110064030 GCTGGCTGGGAAAGGCTGGCTGG - Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
914248218 1:145901385-145901407 TCTGGTTGGCAGAGTCTGTCAGG - Intronic
914804646 1:150983225-150983247 TCGGGCTGTGAGAGGATGGGAGG + Intronic
916211389 1:162362870-162362892 TCTGGATGTCAGATGGTGGGTGG - Intronic
917802190 1:178581048-178581070 TCTAGGGGTCAGAGGCTGGCAGG + Intergenic
917980911 1:180268483-180268505 ACTTGCTGTCAGAAGCTGGCTGG + Intronic
918972713 1:191440353-191440375 ACTGGTTTTCAGATGCTGGCTGG + Intergenic
921918726 1:220642454-220642476 TCTGTCTGTAAGACCCTGGCTGG - Intronic
922088776 1:222376017-222376039 TCTGGCTTTCAGTAGTTGGCTGG - Intergenic
922562753 1:226580923-226580945 TCAGGCTGTGCCAGGCTGGCAGG + Intronic
922866270 1:228863853-228863875 TCTGGCTGAGAGAGACAGGCAGG + Intergenic
924645295 1:245872045-245872067 TGTGGATGTCAGAGGCTGTTTGG - Intronic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1064590944 10:16890306-16890328 TGTGGTTGTCACAGGCAGGCAGG - Intronic
1065781458 10:29172034-29172056 TCTGGCTCTTAGAGCCAGGCTGG - Intergenic
1067662676 10:48248064-48248086 TCTGCCTTTCAGAGCCTGGAGGG + Intronic
1067903911 10:50271078-50271100 TCTGACTGTGACAGTCTGGCAGG - Intergenic
1068132588 10:52913009-52913031 TGTGGTTGTCAGGGGCTGGGAGG + Intergenic
1069171052 10:65229750-65229772 TCTCGCTGTCACACGCAGGCTGG + Intergenic
1070649668 10:78225791-78225813 ACTGGCTGTCAGAGCCCAGCAGG - Intergenic
1071045445 10:81369417-81369439 GTTGGCTGTCAGAGGGTGGAGGG - Intergenic
1071486831 10:86107778-86107800 TCTGCTGGTCAGTGGCTGGCTGG - Intronic
1072363514 10:94684362-94684384 GGTGGCTACCAGAGGCTGGCAGG - Intronic
1072553177 10:96494363-96494385 CCTGGCTCTCAGAGAATGGCAGG + Intronic
1074151377 10:110762688-110762710 TGTGGCTGGCTGTGGCTGGCAGG + Intronic
1074349320 10:112719912-112719934 AGTGGATGTCAGGGGCTGGCAGG - Intronic
1076357592 10:129864326-129864348 GCTGCCTGTCACTGGCTGGCAGG - Intronic
1076636008 10:131882367-131882389 TGGGGCTGCCAGGGGCTGGCGGG - Intergenic
1076720323 10:132389552-132389574 TCTGGCTGAGAAAGGCTGACTGG - Intergenic
1076734323 10:132451983-132452005 GCTGGCTGCCACAGTCTGGCAGG + Intergenic
1076769047 10:132653121-132653143 TCCGTCTGTCCGAGCCTGGCTGG + Intronic
1077132636 11:980943-980965 TCTGGCTCTTCGATGCTGGCAGG + Intronic
1077140827 11:1024129-1024151 TCTGGCTGCCGGGGGATGGCGGG + Intronic
1078346958 11:10558748-10558770 CCTGGCTGTCTGAGGCTAGGTGG - Exonic
1078421333 11:11215494-11215516 TCTGGATGTGAGATGCTGGGAGG + Intergenic
1078519953 11:12054872-12054894 AGTGGCTGTCAGGGGCTGGGTGG - Intergenic
1079242049 11:18728329-18728351 TCTGGGTGTCAGATGCTCTCAGG - Exonic
1079336747 11:19576896-19576918 TCTGGCTGTCTTAGGCTGAGTGG + Intronic
1079967671 11:26998487-26998509 TCTGGCAGTCAGAAGCTGGTTGG + Intergenic
1080801470 11:35614082-35614104 GCTGTCTGCCCGAGGCTGGCTGG + Intergenic
1081174055 11:39903911-39903933 TCTGGATTTTAGAGGTTGGCTGG - Intergenic
1081599625 11:44484182-44484204 TCAGGCTGGCGGAGCCTGGCAGG - Intergenic
1083281821 11:61631494-61631516 GCTGGTTGCCAGGGGCTGGCTGG - Intergenic
1083339450 11:61949692-61949714 TCTGGCTGTGATTGGCTGGCAGG - Intergenic
1083632016 11:64100710-64100732 TCTGGCTGGCAGTGGTTGGGAGG - Intronic
1083921116 11:65781677-65781699 GCGGGCTGTCAGGGCCTGGCCGG + Intergenic
1084120638 11:67066921-67066943 GCTGACTGTCAGAGCTTGGCAGG + Intronic
1085030887 11:73270331-73270353 TTTGGCTGTCAGAGCCTGGAGGG + Intronic
1086726311 11:90189076-90189098 TCTTCCTGTAAGAGGCAGGCAGG + Intronic
1088886940 11:114015186-114015208 TCTGGCAGTCAAAGGAGGGCAGG + Intergenic
1089149879 11:116356453-116356475 TAGGGCTTTCAGAGCCTGGCAGG - Intergenic
1089191340 11:116655640-116655662 TGTGTGTGCCAGAGGCTGGCAGG - Intergenic
1089343073 11:117772804-117772826 ACTGGCTCTCCAAGGCTGGCAGG - Intronic
1089632277 11:119791313-119791335 TCTGGCTGTCAGAGGACAGGAGG - Intergenic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090235004 11:125140522-125140544 CCTGGCTGTGGGAGACTGGCAGG - Intergenic
1090271569 11:125389600-125389622 ACTGCCAGTCAGAGGCTGGTGGG - Intronic
1090640483 11:128725431-128725453 CCTGGCTGCCTGAGGCTGACAGG - Intronic
1090936232 11:131345039-131345061 TCTGGCTGTGAGAGGCTGCTAGG - Intergenic
1091119857 11:133047885-133047907 TCTGGCTCTCAGAGGAAGCCTGG - Intronic
1091759985 12:3080781-3080803 AGTGGCTGCCAGAGGCTGGGAGG - Intronic
1092641101 12:10510727-10510749 TGGGTCTGTCAGAGGCTGTCTGG - Intronic
1092864867 12:12751278-12751300 TCTGGCTGGCATAGGCTGAATGG + Intronic
1092887763 12:12940215-12940237 GGTGGCTGTCAGGGGCTGGAGGG + Intergenic
1096016994 12:48285741-48285763 TCTGAATGTGAGAGGCTTGCTGG + Intergenic
1096408622 12:51361570-51361592 TCTGGCTTTCAGACACAGGCAGG + Intronic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1098377793 12:69836165-69836187 TCTGCCGGTCAGGGGCTAGCCGG + Intronic
1103535848 12:121633340-121633362 TCAGGCGGCCAGTGGCTGGCGGG + Intronic
1103741694 12:123095692-123095714 CCTGTCTGTGAGAGTCTGGCTGG - Intronic
1103913692 12:124365229-124365251 TCTGGGTGCCAGAAGCTGGCAGG + Intronic
1103967388 12:124648458-124648480 TCTGTCTCTCAGAGTCTAGCTGG - Intergenic
1104065648 12:125303157-125303179 TGAGGTTATCAGAGGCTGGCAGG - Intronic
1104779077 12:131408205-131408227 CCGGGCTGTCTGAGGCTGGGAGG + Intergenic
1105038038 12:132940681-132940703 CCTGCCAGTCTGAGGCTGGCCGG - Intronic
1107682377 13:42865217-42865239 TCTGGCTACCAGAGGGAGGCTGG - Intergenic
1107870405 13:44741401-44741423 TTTGGCAGGCAGAGGCAGGCTGG - Intergenic
1108046219 13:46387120-46387142 TTTGGCTGGGTGAGGCTGGCGGG - Exonic
1109548174 13:63856885-63856907 GGTGGTTGTCAGAGGCTGGTGGG - Intergenic
1109971012 13:69769470-69769492 TCTGGCTGTCACTGGCTTGAAGG - Intronic
1111192661 13:84830774-84830796 CAGGGCTGTCAGAGGCTGGAGGG + Intergenic
1112403637 13:99098339-99098361 TGTAGTTGTCAGAGGCTGGAGGG + Intergenic
1112510224 13:100002389-100002411 TCTGGCTTTCAGCAGATGGCTGG - Intergenic
1113436076 13:110292099-110292121 TTTGGCTCTCAGCGGCAGGCAGG - Intronic
1113500223 13:110767479-110767501 GCTGGCTGATAGAGGCTGGGAGG + Intergenic
1114368188 14:22053458-22053480 GGTGGCTGCCAGAGGCTGGGAGG - Intergenic
1117312325 14:54540259-54540281 GGTGGTTGCCAGAGGCTGGCGGG - Intergenic
1117764364 14:59064964-59064986 TCTGCCTGTCAGAGTGTGGTAGG - Intergenic
1117897838 14:60506797-60506819 TCTGCGTGTCTGAGGCTCGCGGG - Intronic
1118373835 14:65159720-65159742 TCTGGCTGTCAGAAATTGTCTGG - Intergenic
1118729130 14:68654485-68654507 TGTCGCTGTCAGTGCCTGGCAGG + Intronic
1119406601 14:74403049-74403071 TCAGGCTGGCAGAGACAGGCTGG - Intergenic
1119420243 14:74503849-74503871 ACTGGCTGGCAGGGGCTGGGTGG + Intronic
1120114871 14:80603325-80603347 TGTGGTTGCCAGAGGCTGGAGGG + Intronic
1120617751 14:86729138-86729160 TCTGGATGTCAGAGACTTGCAGG + Intergenic
1121014415 14:90539580-90539602 TCTGGCTCACTGAGGCAGGCGGG - Exonic
1121825354 14:97005982-97006004 TCTGTCTGTCAGTTGGTGGCAGG + Intergenic
1122036267 14:98951311-98951333 TCTGGCCCTCTGAGGCTGACAGG - Intergenic
1122078899 14:99253570-99253592 AGTGGCTGCCGGAGGCTGGCAGG + Intronic
1122169864 14:99863522-99863544 TGTGGCTGTCAGAGGTTGCAGGG - Intronic
1122268358 14:100557125-100557147 TGTGGCTGGAAGAGGCCGGCAGG - Intronic
1122715233 14:103693006-103693028 TGTGGCTGTCAGTGGGTGGCCGG + Intergenic
1122769699 14:104092503-104092525 TATGACAGTCAGAGGCTGGGAGG - Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124182676 15:27491362-27491384 GCTGCCTGTCTGAGGCTGGGAGG - Intronic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125183961 15:36909721-36909743 TCTGGCTTTTCTAGGCTGGCAGG + Intronic
1127948285 15:63777746-63777768 TCTGGGTGTGAGAGTCGGGCAGG - Intronic
1128260278 15:66228340-66228362 TCTGGCTGTCTGTGGAGGGCTGG - Intronic
1129322374 15:74782304-74782326 TCCGGCGGCCAGAGGCTGGCTGG - Exonic
1131256042 15:90863110-90863132 CCAGGCTGACTGAGGCTGGCAGG - Intergenic
1132065594 15:98728279-98728301 CCTGTCTGTGAAAGGCTGGCCGG + Intronic
1132936035 16:2481728-2481750 TCTGGCTATGAAAGGGTGGCTGG + Intronic
1135060393 16:19266636-19266658 TCTGGCTGGCATGGGATGGCAGG + Intronic
1135538897 16:23314981-23315003 GCTGGATTTCAGAGGTTGGCAGG + Intronic
1135964325 16:27023295-27023317 TCTGGCTGGGCTAGGCTGGCTGG - Intergenic
1136406913 16:30053426-30053448 TCTGGGTCTCAGAGGCTGAGAGG - Intronic
1136420695 16:30130816-30130838 TGTGGTGATCAGAGGCTGGCAGG + Intergenic
1137306555 16:47206538-47206560 TCTGGTTCCCAGAGGCTGGTAGG - Intronic
1138679530 16:58674974-58674996 TCTGGCTGCCAGTGCCTGTCTGG + Intronic
1138760778 16:59541133-59541155 TTTGGATGTCAGTGGGTGGCAGG - Intergenic
1139041321 16:63002180-63002202 TCTGAATTTCAGAGGATGGCTGG + Intergenic
1139614426 16:68080325-68080347 TCTGCCTGTGTGAGGCTGGCTGG + Intergenic
1141217156 16:82035359-82035381 TCTAGCGGGCAAAGGCTGGCTGG - Exonic
1141495137 16:84404353-84404375 GGTGGGTGTCAGAGGCTGGAGGG - Intronic
1141676570 16:85520910-85520932 GCCAGCTGTCAGAGGGTGGCGGG - Intergenic
1141832112 16:86515692-86515714 TCTGGCCTGCAGAGGCTGACCGG - Intergenic
1143496369 17:7315084-7315106 TCTGGCAGTCAGAGACAGCCGGG - Exonic
1143675198 17:8427323-8427345 GCTGGCTGTTTGTGGCTGGCTGG + Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144066351 17:11627922-11627944 TCAGGCTGGCACAGGCTGCCTGG - Intronic
1145297467 17:21602493-21602515 AGTGGCTGTCAGCAGCTGGCAGG + Intergenic
1145366477 17:22270372-22270394 AGTGGCTGTCAGCAGCTGGCAGG - Intergenic
1145781324 17:27565835-27565857 GCTGGCTATCAGTGGCTGGCAGG - Intronic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148085527 17:44991564-44991586 ACTGGCTGCAAGAGGCTGGGTGG + Intergenic
1148146393 17:45367623-45367645 TTTGGAGGTCAGAGGCTGCCAGG + Intergenic
1148156645 17:45428447-45428469 AGTGGCTGTCAGCAGCTGGCAGG + Intronic
1148341280 17:46875006-46875028 TCTGGCCCTCAGAGGGCGGCAGG + Intronic
1149857091 17:60092292-60092314 TATGAGTGGCAGAGGCTGGCTGG + Intergenic
1150973191 17:70053818-70053840 TCTTGCAGTCAGAGGCTGCATGG + Intronic
1151434883 17:74089095-74089117 TGTGGCTCTCACAGGCTGGAAGG + Intergenic
1151896242 17:76982758-76982780 TCTGGCTGTGCGAGTCTGGGTGG - Intergenic
1151977346 17:77490232-77490254 TGTGGGTGGCAGGGGCTGGCAGG - Intronic
1152065915 17:78112449-78112471 TCTGGCTGCCAGCAGCTGGCTGG - Exonic
1152207257 17:78980803-78980825 GCTGGCTCTCACCGGCTGGCTGG - Intergenic
1152511786 17:80794913-80794935 TGTGGCTGTGAGGGGCTAGCGGG + Intronic
1152562625 17:81086137-81086159 TCTGGCTCTCAGTGGTGGGCGGG + Intronic
1152636106 17:81431126-81431148 TCTGGCTGAGAGAAGCTGGCGGG - Intronic
1152806174 17:82357387-82357409 TCTGGGGGTCAGAGGCTCCCGGG - Intergenic
1154282033 18:13012127-13012149 ATTGGTTGTCAGAGGCTGGAAGG + Intronic
1155343194 18:24833412-24833434 TCTGGCTGAAAGAGGCAGTCTGG - Intergenic
1157802401 18:50631452-50631474 TGTTGCCATCAGAGGCTGGCAGG + Intronic
1158109863 18:53929088-53929110 GCTGGCTGTGGGAGGCTGGCTGG - Intergenic
1159420043 18:68206184-68206206 TCTGGATCTCAGAGTGTGGCAGG - Intergenic
1161537731 19:4830728-4830750 TGTGGCTCTGAGAGACTGGCTGG + Intronic
1161609873 19:5236610-5236632 TCTGGGTTTCAGATGCTAGCAGG - Intronic
1161776231 19:6263738-6263760 TCTGCCTTTCAGAAACTGGCAGG - Intronic
1162199720 19:9011284-9011306 TCTGACTGTTAGAGGCTAGAGGG - Intergenic
1162910837 19:13847214-13847236 TCTGGCTGTCCCTGCCTGGCTGG + Intergenic
1163042079 19:14610056-14610078 TCTGGCTCCCAGAAGCTGGATGG - Exonic
1163204223 19:15790521-15790543 TCTGGCTGTCAGAAGAGGGATGG + Intergenic
1163560175 19:18014333-18014355 TCGGAGTCTCAGAGGCTGGCGGG + Intergenic
1163763718 19:19150850-19150872 TCTTCCTCTCAGTGGCTGGCAGG - Intronic
1163813929 19:19452340-19452362 TGTGGCTGTCAGAGGTTGATGGG + Intronic
1164753167 19:30670830-30670852 TCTCGCTGTTACAGCCTGGCAGG - Intronic
1165214947 19:34264309-34264331 TCTGCCTGCCTCAGGCTGGCTGG - Intronic
1165917630 19:39270295-39270317 TCTGCAGGTCAGAGGCTCGCTGG + Intergenic
1166283496 19:41810080-41810102 TCTGCCTGGCAGTGACTGGCAGG - Intronic
1166454878 19:42932535-42932557 TCAGGGTGTCAGAGGCTGGAAGG - Intronic
1167249826 19:48393884-48393906 TCCGGGTGTCTGGGGCTGGCTGG + Intergenic
1167572599 19:50298521-50298543 TCTGGGAGGCCGAGGCTGGCAGG + Intronic
1168233392 19:55047197-55047219 CGGGGCTGTTAGAGGCTGGCAGG + Intronic
929455895 2:42065250-42065272 TTTGGGTGGCTGAGGCTGGCGGG + Intergenic
929983232 2:46699601-46699623 TCTGGCTGGGATGGGCTGGCCGG + Intronic
931188310 2:59975156-59975178 TCAGATTGCCAGAGGCTGGCAGG + Intergenic
931344228 2:61431557-61431579 TTTAGCTAGCAGAGGCTGGCCGG + Intronic
932046219 2:68352730-68352752 TCTTGCTCCCAGTGGCTGGCTGG + Intergenic
932434448 2:71694989-71695011 TCGGGGTGTCTGAGGCTGGGAGG + Intergenic
933833742 2:86230092-86230114 TCTGGCTGTCCCAGGCTGAGAGG - Intronic
933836814 2:86252454-86252476 TCTGGCAGTCAGTTGGTGGCAGG - Intronic
933991182 2:87634897-87634919 TCTGGCTGGTAGAGGCAGGAGGG + Intergenic
934060376 2:88286811-88286833 TGTGGTTGTTAGAGGCTGGTAGG - Intergenic
934490202 2:94757056-94757078 TGTGGCAGTCAGGTGCTGGCAGG - Intergenic
936018869 2:108979830-108979852 GCTGGCTGTCAGGGCCTAGCAGG - Intronic
936302657 2:111315926-111315948 TCTGGCTGGTAGAGGCAGGAGGG - Intergenic
936360068 2:111790895-111790917 GGTGGCTGCCAGAGGCTGGTGGG + Intronic
937217458 2:120321716-120321738 TCTGGCTGTGAGGGACCGGCAGG + Intergenic
937885249 2:126895078-126895100 CCTGGCTGTCAGAGTCTGGGTGG - Intergenic
942228611 2:173838577-173838599 TTTGGCTGGAACAGGCTGGCAGG - Intergenic
945072983 2:206009595-206009617 ACTGGCAGTGAGACGCTGGCGGG + Exonic
946737759 2:222771749-222771771 TCTGGGAGGCAGAGGCGGGCTGG - Intergenic
947907614 2:233776836-233776858 CCTGGCTGACAGAGTGTGGCAGG + Intronic
948197412 2:236106100-236106122 TCTGGCTGCCCTTGGCTGGCTGG + Intronic
948272904 2:236687739-236687761 ACTGGCAGTCACAGGGTGGCAGG + Intergenic
948528900 2:238590298-238590320 CCGGGGTGTCAGAGGCAGGCTGG + Intergenic
948863988 2:240766250-240766272 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
1168968216 20:1912978-1913000 TCAGGCCGTCTGATGCTGGCTGG + Intronic
1169374981 20:5059250-5059272 TCTGAATGACAGAGGCTGGGAGG - Intergenic
1170913452 20:20598678-20598700 TCTTGCTCTCACAGGCTGTCAGG - Intronic
1171149150 20:22811536-22811558 CCTGGCTTTCAGAGGCTCCCTGG - Intergenic
1171880064 20:30611796-30611818 TGTGGCAGTCAGGTGCTGGCAGG - Intergenic
1172233452 20:33352837-33352859 TCTTGCTGTCAGAGGCTGACCGG - Intergenic
1172602574 20:36194222-36194244 TCTCGCTGACCGAGGCTGGGCGG - Exonic
1173334363 20:42100958-42100980 TCTGGGTGTTAGAGGCAGGAGGG - Intronic
1173371310 20:42438996-42439018 TCTGGCACTCAGAGTCTGGAAGG - Intronic
1173454615 20:43192157-43192179 TGTGGGTGCCAGAGCCTGGCCGG - Intergenic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1174408980 20:50321478-50321500 TGTGGCTGTGAGGGCCTGGCTGG + Intergenic
1174475811 20:50795045-50795067 TCCGGCTGGCGGAGGCTGCCTGG - Exonic
1174959197 20:55136076-55136098 TAAGGCTGTCAGACGTTGGCTGG - Intergenic
1175501218 20:59452596-59452618 TGTTGTTTTCAGAGGCTGGCAGG - Intergenic
1175676136 20:60948399-60948421 TCAGGGTCTCATAGGCTGGCAGG + Intergenic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1175877025 20:62235221-62235243 CCTGGCTGGCAGCTGCTGGCTGG - Intronic
1175967149 20:62665455-62665477 TCTCGGTGCCAGAGGCAGGCTGG + Intronic
1176057499 20:63156359-63156381 GCTGGCTGCCAGCTGCTGGCAGG + Intergenic
1176079595 20:63265593-63265615 TCTGGCTGTCGGCAACTGGCTGG + Intronic
1179959369 21:44759476-44759498 TTTGGCTGACAGTGGCTGGTAGG + Intergenic
1180048879 21:45322315-45322337 TGTGGCTCTCAGAGCCAGGCTGG - Intergenic
1180213934 21:46312999-46313021 TCTAGCTGTGTGAGGCTGCCTGG + Intronic
1180844368 22:18973282-18973304 TCTGGCTTTCAGAGACCTGCTGG - Intergenic
1181048798 22:20229022-20229044 TCTGGCTGGCATGGGCTGCCTGG + Intergenic
1181057104 22:20265429-20265451 TCTGGCTTTCAGAGACGTGCTGG + Intronic
1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG + Intronic
1181522582 22:23458207-23458229 CCCGGCCCTCAGAGGCTGGCAGG - Intergenic
1181620978 22:24091009-24091031 TCAGGCTGTGAGAGGGTGGCTGG + Intronic
1181775736 22:25159016-25159038 TGTGGGTGTCAGAGGTAGGCAGG - Intronic
1182196401 22:28522848-28522870 AGTGGTTGTCAGAGGCTGGAAGG + Intronic
1182817951 22:33183831-33183853 GGTGGTTGTCAGAGGCTGGGGGG + Intronic
1183539283 22:38420178-38420200 TTTGGCCTTCAGAAGCTGGCAGG - Intergenic
1183654281 22:39175935-39175957 TCTGGGTATCAGAGTCTGACTGG + Intergenic
1183932025 22:41240776-41240798 TGGGCCTCTCAGAGGCTGGCGGG - Intronic
1184946631 22:47808551-47808573 TGTGGCTCTTGGAGGCTGGCCGG - Intergenic
949852702 3:8434860-8434882 CCAGGCACTCAGAGGCTGGCAGG - Intergenic
949939931 3:9147221-9147243 TCTGGAAGTCAGAGCCTGCCAGG + Intronic
952010992 3:28901245-28901267 TCTGCCAGTAAGTGGCTGGCTGG + Intergenic
952750587 3:36821806-36821828 TCTGGCTGTCACAGACGGACAGG - Intergenic
952889683 3:38031552-38031574 CCTGGCTCTCACAGGCTGGGAGG + Intergenic
953151516 3:40329421-40329443 TGAGGCTGTGAGAGACTGGCTGG - Intergenic
954289541 3:49642461-49642483 CCTGGCTGTCTCAGCCTGGCGGG - Exonic
954293820 3:49663303-49663325 TCTTGCTGTCAGAGGCATGATGG - Exonic
954583025 3:51713341-51713363 GCTGGCTGTCAGAGGATGAGGGG + Intronic
954770890 3:52967398-52967420 TATGGATGTCAGAGTCTGGGTGG + Intronic
956248190 3:67207645-67207667 CCAGACTGTAAGAGGCTGGCAGG + Intergenic
956929529 3:74027323-74027345 TTTGGCTGGCAGTGGGTGGCGGG - Intergenic
957822914 3:85401311-85401333 TCTGGCAGACAGAGGCTGAGAGG - Intronic
960973906 3:123157501-123157523 TCTGGCTGTCAGTGACCCGCTGG - Intronic
961422198 3:126815328-126815350 TCTGGCATACAGAGGATGGCTGG - Intronic
961524976 3:127490843-127490865 GCTGGCTGTCAGGAGCTGGATGG - Intergenic
961653540 3:128429243-128429265 TCTGGCTGTGAGATGAGGGCAGG - Intergenic
963900710 3:150730569-150730591 TCTGGCAGGCCAAGGCTGGCAGG - Intergenic
964901972 3:161670877-161670899 TGTGGCTGTGACAGGCTGGGTGG + Intergenic
965193886 3:165568710-165568732 GCTGACTGCCAGGGGCTGGCTGG + Intergenic
965862294 3:173161310-173161332 TCTGGCTGGCAGGGGTTGGGGGG + Intergenic
966240627 3:177752030-177752052 TCAGCATGTCAGATGCTGGCTGG - Intergenic
966280733 3:178224004-178224026 TCAGGCTTTCAGAGTCAGGCTGG - Intergenic
967604898 3:191433524-191433546 TCTGGCTGTCTTACCCTGGCTGG + Intergenic
968693737 4:2009873-2009895 TCTGGGAGGCAGAGGCGGGCGGG - Exonic
968716705 4:2165400-2165422 AGTGGCTGTCAGGGGCTGGTGGG + Intronic
969475437 4:7420086-7420108 TCTGGCTGACAGAGTGTGGCTGG - Intronic
970043240 4:11820561-11820583 TCTGAGTCTCAGAGGCTGGATGG + Intergenic
971646101 4:29205751-29205773 TCCAGCTTTCAGAGGCTGCCTGG + Intergenic
972206511 4:36779535-36779557 TCTGGTTGCCAGAGGATGGAGGG - Intergenic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
973976228 4:56265126-56265148 TGTGGCTGTCAGAGTTTTGCTGG - Intronic
975719503 4:77236267-77236289 TCTAACTGTCAGAGGATGGATGG + Intronic
976544357 4:86317377-86317399 TCTGGCCCTCAGAGGTGGGCAGG - Intronic
977697744 4:99985545-99985567 TCTGGCTGCCAGAGGCCAGCAGG + Intergenic
978618304 4:110616566-110616588 TTTAGATGTCAGAGGATGGCAGG + Intergenic
978705733 4:111708243-111708265 TCTGGGAGGCTGAGGCTGGCAGG - Intergenic
980220675 4:129909717-129909739 TGGGGCTTTCAGAGGCTGGAGGG + Intergenic
980934075 4:139209690-139209712 GGTGGCTGCCAGAGGCTGGGGGG - Intergenic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985059620 4:186064051-186064073 GGTGGCTGTCAGGGGCTGGGAGG + Intergenic
985328913 4:188805120-188805142 GTTGGCAGTCAGAGGTTGGCTGG - Intergenic
985587857 5:750260-750282 TCTTGCAGTCTGAGGCAGGCAGG + Intronic
985602524 5:842727-842749 TCTTGCAGTCTGAGGCAGGCAGG + Intronic
985700237 5:1367194-1367216 AGTGGTTGTCAGAGGCTGGGGGG + Intergenic
987403780 5:17504250-17504272 TCTGGTTGTCAGGGGCTGGGTGG - Intergenic
987411247 5:17616995-17617017 TCTGGTTGTCAGGGGCTGGGTGG - Intergenic
987413677 5:17640311-17640333 TCTGGTTGTCAGGGGCTGGGTGG - Intergenic
987841265 5:23225451-23225473 CCTGGCTTTTAGAGCCTGGCAGG + Intergenic
988242403 5:28631275-28631297 TCTTGCTGTCAGAGGCATGTTGG + Intergenic
988782186 5:34532451-34532473 TCTGGCTGACAAGGGCTGCCCGG + Intergenic
989101327 5:37826048-37826070 TCTGAGTGTCATGGGCTGGCAGG + Intronic
989169134 5:38457928-38457950 GCTGGTTGTCAGGGGCTGGGGGG + Intronic
990468517 5:56091565-56091587 TCTGGCTGTCAAAGTCTTCCTGG + Intergenic
992444323 5:76820093-76820115 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
993500904 5:88665846-88665868 GCTGTCTGTCATAGGCTGCCCGG + Intergenic
993659996 5:90621708-90621730 TAAGGATGTCAGAGGCTGCCTGG - Intronic
994714206 5:103302433-103302455 GGTTGCTGTCAGATGCTGGCTGG + Intergenic
996254485 5:121381995-121382017 ATTGGTTGTCAGAGGCTGGGAGG - Intergenic
996541287 5:124632074-124632096 CTTGGGTGTCAGAGGCTGGTGGG - Intergenic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
997983083 5:138482158-138482180 TCTGTCTGTTAGAGGCTGGCGGG + Intergenic
998142882 5:139709836-139709858 TCTGGCTGTGGGAAGCTGGCGGG + Intergenic
998252843 5:140564260-140564282 GCGGGCCGGCAGAGGCTGGCGGG - Exonic
999333486 5:150694635-150694657 TTTCGCTGTAAGAGGCTGGATGG - Intronic
1000209669 5:159097884-159097906 TCCGGCTGTCAGTGGCCGCCTGG - Intronic
1001048847 5:168397891-168397913 ACTGGCTGTCATAGCCTGGCTGG - Intronic
1001175718 5:169467218-169467240 TCTGGCTCTAAGAGGAAGGCTGG + Intergenic
1001428958 5:171644720-171644742 TCTGGTTGTCAAATGCAGGCTGG - Intergenic
1001542346 5:172548396-172548418 TCTAGCTGTCAGAGGCTGGGCGG - Intergenic
1001766419 5:174251170-174251192 TCTGGCAGTTAGTGGCTGGGTGG + Intergenic
1002337187 5:178487966-178487988 GCTGGCTGTGAGACCCTGGCTGG + Intronic
1002437602 5:179241343-179241365 TGTGCCTCACAGAGGCTGGCTGG - Intronic
1003440823 6:6139924-6139946 TCTGGATGTCAGGGGATGGCTGG + Intergenic
1004232779 6:13847994-13848016 TCTTGGTGTCACAGGCTGACGGG - Intergenic
1004285043 6:14313841-14313863 TCAGGCGGCCTGAGGCTGGCTGG + Intergenic
1006011035 6:31043082-31043104 TCTGCCTGTGTGAGGCTGGAAGG - Intergenic
1006363509 6:33600847-33600869 TCTGGCTGTGGGAGATTGGCTGG + Intergenic
1006368555 6:33630623-33630645 TCTGGCTGTCAGGGTCAGGCGGG - Intronic
1006392095 6:33764461-33764483 AGTGGCTGGCAGGGGCTGGCAGG - Intergenic
1006442342 6:34060325-34060347 TCTGGCCATCTCAGGCTGGCCGG - Intronic
1008125620 6:47665204-47665226 TCTGACTGTCAGAGGCTGCCAGG - Intronic
1009435302 6:63610742-63610764 TTTGGGAGGCAGAGGCTGGCGGG + Intergenic
1009628166 6:66163151-66163173 GATGGCTATCAGGGGCTGGCCGG + Intergenic
1009717148 6:67412440-67412462 TCTTGCAGTCAGAGGCTGCATGG - Intergenic
1010423518 6:75701012-75701034 AATGGCTGTCATAGGCTGGCTGG - Intronic
1010616567 6:78020289-78020311 TTTTGAAGTCAGAGGCTGGCAGG + Intergenic
1014720595 6:124913051-124913073 TATGGCTGTCAGGGGCTGGGAGG - Intergenic
1015826685 6:137320226-137320248 TGTGGGTGCCACAGGCTGGCCGG - Intergenic
1015931692 6:138366944-138366966 TCTGGCTGGCAGGGGTTGGGGGG + Intergenic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1017147351 6:151246681-151246703 TCTGGCTGTCAGAGCATGAAAGG + Intronic
1018041836 6:159931401-159931423 GCTGGTTGCCAGAGGCTGGAGGG + Intergenic
1018417687 6:163615322-163615344 GCTGGCTGACATAGGCTGGGTGG + Intergenic
1018841277 6:167518771-167518793 TCTGGCTGTCACCCGCCGGCAGG - Intergenic
1019577874 7:1746222-1746244 TCTGGCTGTCGGGGCCCGGCCGG - Exonic
1019588742 7:1818337-1818359 CCCGGCCCTCAGAGGCTGGCAGG + Intronic
1020028719 7:4918123-4918145 TCCTGTAGTCAGAGGCTGGCTGG - Intronic
1020035924 7:4963078-4963100 AGTGGCTGTCTGAGCCTGGCTGG - Intergenic
1021860857 7:24904827-24904849 GGTGGCTGTCAGGGGCTGGGGGG + Intronic
1023849536 7:44142317-44142339 TATGTCTGTCAGTAGCTGGCTGG + Intergenic
1027244138 7:76354611-76354633 TGTGGCTGTCAGGAGCTGGATGG - Intronic
1029204433 7:98860449-98860471 TCTGGCTGTCAGAGCTAGGCAGG + Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1030068660 7:105679756-105679778 TGTGGTTGTCAGGGGCAGGCTGG + Intronic
1032016222 7:128381829-128381851 ACTGGCTGTGAGGGCCTGGCGGG - Intergenic
1032087888 7:128893247-128893269 GCTGGCGGCCAGAGGCAGGCAGG + Exonic
1033741676 7:144280884-144280906 TCTGCCTTTCAGAGGCAGGGAGG - Intergenic
1033752225 7:144368730-144368752 TCTGCCTTTCAGAGGCAGGGAGG + Intronic
1033879935 7:145868932-145868954 TGTGGCTGTAACAGGCTGGGTGG + Intergenic
1034411847 7:150946154-150946176 TCTGGCTGCCAGAGGCGGCCTGG - Intronic
1034958739 7:155351293-155351315 TCTGGCTGCCAGTGGCTCCCTGG - Intergenic
1035682142 8:1495917-1495939 CTTGGCTGTCAGAGGCTCTCGGG - Intergenic
1037255922 8:16953525-16953547 GATGGTTATCAGAGGCTGGCTGG + Intergenic
1037837795 8:22224433-22224455 TCTGGCGGACAGAGGTTGGCCGG - Intronic
1041063320 8:54057644-54057666 TATGGTTATCAGAGGCTGGAAGG + Intronic
1044901539 8:96950925-96950947 TCTGGGTTTCAGAGGCAAGCAGG - Intronic
1046700474 8:117395299-117395321 ATTGGCTGTCAGGGGCTGGGTGG - Intergenic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1048330644 8:133468444-133468466 CGTGGCTGTCAGGGGCTGGGAGG + Intronic
1049363327 8:142224699-142224721 TGTGGCTGTCAGAGCCAGGGAGG + Intronic
1049400455 8:142424455-142424477 TCTGGCTGCCGGGGGCTGGCTGG + Intergenic
1049592687 8:143469733-143469755 TCTGTCTGTAAAAGGCAGGCAGG - Intronic
1051474547 9:17490561-17490583 TGTGGTTGCCAGAGGCTGGGGGG + Intronic
1052741239 9:32394947-32394969 TCTGGCTGTCAGAGGTCTTCTGG - Intronic
1053054501 9:34986571-34986593 TCTGGGTGTGGGAGGCTGCCAGG - Intergenic
1053917381 9:42953761-42953783 TGTGGCAGTCAGGTGCTGGCAGG + Intergenic
1055042723 9:71892949-71892971 GGTGGTTGCCAGAGGCTGGCAGG - Intronic
1055324410 9:75113953-75113975 AGTGGTTGCCAGAGGCTGGCGGG - Intronic
1057480542 9:95441922-95441944 TCTGGATCTCAGGGGCTGGCCGG - Intergenic
1057828937 9:98392522-98392544 TCTGGTTCTCAGAGGCTGACTGG + Intronic
1058402543 9:104634924-104634946 TCTGTCTGGCTGAGTCTGGCTGG + Intergenic
1058599830 9:106657341-106657363 TCTGGCTCACAGAGCCTTGCAGG - Intergenic
1058879644 9:109275272-109275294 TCTGCATGTCAGGGGCTGGGTGG + Intronic
1058939978 9:109804037-109804059 TTCAGCTGTCAGAGCCTGGCTGG - Intronic
1059329449 9:113525660-113525682 TCTGGCTGGTTGGGGCTGGCAGG + Intronic
1060217909 9:121749371-121749393 TCTGCCTGTCATAGCCAGGCAGG - Intronic
1060274600 9:122172863-122172885 ACTGTATGTCAGACGCTGGCTGG + Intronic
1061147432 9:128808149-128808171 TCTGGCACTGGGAGGCTGGCAGG + Exonic
1061396017 9:130343651-130343673 TGTGGCAGTCAGGGGCTGGGTGG - Intronic
1061589387 9:131588815-131588837 CCGGGCTGCCAGGGGCTGGCTGG + Exonic
1061805309 9:133134422-133134444 TCTTTCTGGCAGAGGCTGTCTGG - Intronic
1062003852 9:134229725-134229747 TCTGGCTCCCAGCGACTGGCGGG - Intergenic
1062004936 9:134234322-134234344 GGTGACTGTCAGACGCTGGCAGG + Intergenic
1062359837 9:136182465-136182487 GCATGATGTCAGAGGCTGGCAGG - Intergenic
1062453351 9:136624701-136624723 GCTGGCTCTGAGAGACTGGCTGG - Intergenic
1062515060 9:136928923-136928945 GCTGGCTGTCAGGGGCTGAGCGG - Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185506034 X:632723-632745 TCTCACTGTCAAAGGCAGGCTGG - Intronic
1185946211 X:4379366-4379388 TCTGGCAGCCAGAGACTGCCTGG + Intergenic
1186477924 X:9873106-9873128 TGTGGTTGCCAGAGGCTGGAGGG + Intronic
1186561466 X:10618091-10618113 TCTGGCTATCAGTGGCAGGCAGG + Intronic
1186659513 X:11655058-11655080 ACTTGTTGTCAGAGGCTGGTAGG - Intronic
1187137091 X:16558488-16558510 TCTGGCTTTCAGACGCAGACTGG - Intergenic
1187280160 X:17852473-17852495 TATCACTCTCAGAGGCTGGCAGG + Intronic
1189464885 X:41271078-41271100 ACTGGCTGCCAGGGGCTAGCCGG + Intergenic
1192170202 X:68849704-68849726 TCTGGCTGCTAGAGTCTGGCTGG - Intergenic
1192604731 X:72504340-72504362 ACTGGTTGTCAGAGGCTGGAAGG - Intronic
1201176833 Y:11314863-11314885 ACTGGCAGAGAGAGGCTGGCGGG - Intergenic