ID: 1181463669

View in Genome Browser
Species Human (GRCh38)
Location 22:23099429-23099451
Sequence CACCCAGCTGGGGCTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 322}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181463659_1181463669 -4 Left 1181463659 22:23099410-23099432 CCAGTGCCCCCAAGCCCAACACC 0: 1
1: 0
2: 1
3: 29
4: 451
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1181463660_1181463669 -10 Left 1181463660 22:23099416-23099438 CCCCCAAGCCCAACACCCAGCTG No data
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1181463656_1181463669 17 Left 1181463656 22:23099389-23099411 CCTGCAGGTGTGTCAGGCACCCC 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1181463658_1181463669 -3 Left 1181463658 22:23099409-23099431 CCCAGTGCCCCCAAGCCCAACAC 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1181463657_1181463669 -2 Left 1181463657 22:23099408-23099430 CCCCAGTGCCCCCAAGCCCAACA 0: 1
1: 0
2: 3
3: 53
4: 416
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1181463654_1181463669 23 Left 1181463654 22:23099383-23099405 CCAAGTCCTGCAGGTGTGTCAGG 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181463669 Original CRISPR CACCCAGCTGGGGCTTCCTC AGG Intronic
900367355 1:2316643-2316665 CCCCCAGCTGGGGCTTGCAAGGG - Intergenic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900396876 1:2456714-2456736 CAGGGAGCTGGGCCTTCCTCTGG + Intronic
900431979 1:2606815-2606837 AACCCAGCCGGGGCAACCTCAGG - Intronic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
900628288 1:3619667-3619689 CACCCGGCTGGGGAGGCCTCAGG - Intergenic
900830920 1:4964837-4964859 CCCAGAGCTGGTGCTTCCTCAGG + Intergenic
900986198 1:6073986-6074008 CACCCAGCAGTGGATGCCTCGGG + Intronic
901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG + Intronic
902199915 1:14825731-14825753 CACACAGGTGGGGCTTGATCAGG - Intronic
903950592 1:26993952-26993974 GACGCAGCTGGGGCTTCAGCAGG + Exonic
904404792 1:30279342-30279364 AACCCTTCTGGGGCTACCTCGGG - Intergenic
905213112 1:36387953-36387975 CAACCCCCAGGGGCTTCCTCAGG + Intergenic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
907046390 1:51302639-51302661 AACCCAGCAGGGGCTTCCCAGGG + Intronic
907248694 1:53123641-53123663 CATCCAGCTGTGCCCTCCTCTGG - Intronic
909568994 1:77086835-77086857 CATGCGGCTTGGGCTTCCTCAGG + Intergenic
911753934 1:101531156-101531178 CATCCACCTGGGGTTTGCTCTGG + Intergenic
912269247 1:108192650-108192672 CACCCCGCTGGGGCTCACTCAGG - Intronic
913193489 1:116433318-116433340 CACCCAGCTGGTGATGGCTCAGG + Intergenic
913314101 1:117535424-117535446 CAGCCTGCTGGGGCCTCCACTGG + Intergenic
914755734 1:150560777-150560799 TGCCCAGCTGGGCCTTGCTCTGG - Exonic
915304262 1:154968882-154968904 CACTCAACTGGGGCTGCCACAGG + Intronic
917523536 1:175767638-175767660 CACCCACCGGGGGCTCCCTGAGG + Intergenic
917972545 1:180218180-180218202 CAGCCAGCTGGGCCCTCCTCTGG - Intergenic
918041558 1:180916901-180916923 CACCCAGCAGGGCCGTCCTGGGG - Exonic
920254094 1:204642595-204642617 CACACAGCTGGCTCTGCCTCAGG + Intronic
920399753 1:205669523-205669545 CCCCCAGCCTGGGCTTCCACGGG - Intronic
920403096 1:205689462-205689484 CACCCAGCTGATGCGGCCTCAGG - Intergenic
920440843 1:205979473-205979495 GACCGAGAAGGGGCTTCCTCTGG - Intronic
921130358 1:212214547-212214569 GCCCCAGGTGGGGCTTCCTCGGG + Intergenic
922235718 1:223721236-223721258 GACCCAGCTGGAGCCTCCACTGG + Intronic
922452594 1:225748847-225748869 CACGGTGCTGGGGCTTTCTCTGG + Intergenic
923322990 1:232854976-232854998 CACCCAGCTGAAGATGCCTCTGG - Intergenic
923514996 1:234689378-234689400 CGCCCAGTTGTGGCGTCCTCTGG + Intergenic
924571567 1:245241708-245241730 CAGCCAGCTGGGGCTGCCATGGG - Intronic
1063551184 10:7035184-7035206 CACCGTGCTGGGGCGGCCTCAGG + Intergenic
1063612669 10:7576368-7576390 CTTCCTGCTGGGGCTTCCTGTGG + Intronic
1065611536 10:27476000-27476022 CACCCACCTGGGCCTGCCTCAGG - Intergenic
1066300890 10:34094520-34094542 CAGACAGGTGTGGCTTCCTCTGG - Intergenic
1067066148 10:43105375-43105397 CACCCAGCTGGGCCTTGCCTCGG + Intronic
1067289784 10:44932407-44932429 CTCCCAGCTGGGCCTTCTGCAGG - Intronic
1067783669 10:49227287-49227309 CACTCAGATGGGGCTGCCTCAGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068114382 10:52720902-52720924 TAGCCTGCTTGGGCTTCCTCAGG + Intergenic
1069959295 10:72070222-72070244 GACCCAGCTGGGGCCTCCGGAGG - Intronic
1071126296 10:82339346-82339368 CACATAGCTGGGGAGTCCTCAGG + Intronic
1072611008 10:97017706-97017728 GACACAGCTGGGGCTGCCACTGG - Intronic
1073666401 10:105539089-105539111 CTCCCAGCGGTGGCTCCCTCAGG - Intergenic
1074899969 10:117807603-117807625 CACACAGATGTGGCTACCTCTGG + Intergenic
1075975490 10:126690497-126690519 CAACCACCTTGGGCTTCCTGAGG - Intergenic
1077765081 11:5149932-5149954 CACCCACCTGGTGGATCCTCTGG - Intergenic
1078064907 11:8072002-8072024 CTCCCACCTGTGCCTTCCTCAGG + Intronic
1078874565 11:15379878-15379900 CACACAGCTCTGGCTTTCTCGGG + Intergenic
1079042080 11:17068244-17068266 CACCCAGCTGGGCCCCTCTCAGG - Intergenic
1079380594 11:19934041-19934063 CGTCCAGCTGGGGCTTCTGCTGG - Exonic
1079865042 11:25724106-25724128 CACACAGCTGGGTACTCCTCTGG - Intergenic
1080443589 11:32317205-32317227 CAGCCAGCAGGGGCTTTCTAGGG - Intergenic
1080962279 11:37174437-37174459 CACACAGCTGGGGAGGCCTCAGG - Intergenic
1081852175 11:46281441-46281463 CTCCCAGCTGGGGCTTCTCTGGG - Intronic
1082890974 11:58138251-58138273 TCCCCAGCTGGGGCTGCCTGAGG + Intronic
1083245976 11:61428891-61428913 CACCCACCTTTGGCTTCCTGGGG + Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1084440920 11:69172732-69172754 CAACCTGCTGGGGCTGCCACAGG + Intergenic
1084455532 11:69266075-69266097 CACACAGCTGCTGCTTGCTCAGG + Intergenic
1084518056 11:69647014-69647036 CCCTCACCTGGGGCTTCCTGGGG - Intronic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1086769678 11:90746000-90746022 CACACAGGTGGGGCGGCCTCAGG - Intergenic
1087729890 11:101767259-101767281 CACACAGCTGGGGCGGTCTCAGG + Intronic
1087818005 11:102679969-102679991 CACAGAGCTGCAGCTTCCTCAGG - Intergenic
1088653212 11:111976661-111976683 CCCCCAGATGTGGCTTGCTCAGG + Intronic
1090500436 11:127255601-127255623 GTCTGAGCTGGGGCTTCCTCTGG + Intergenic
1090758604 11:129816111-129816133 AGCCCAGCTGGGGCCCCCTCCGG + Intronic
1090838713 11:130472054-130472076 CTCCCAGCTTGAGCTTCCTGAGG + Intronic
1091657201 12:2354317-2354339 CACACAGCTTGTGTTTCCTCTGG + Intronic
1091768278 12:3136023-3136045 TACCAAGCTGGGGACTCCTCGGG - Intronic
1094677486 12:32635196-32635218 TACCAAACTGGGGCTTTCTCAGG + Intronic
1095465372 12:42483563-42483585 CACCCTGCTGGGGTCTCCTCCGG - Intronic
1095465666 12:42485552-42485574 CACTCTGTTTGGGCTTCCTCAGG + Intronic
1095960735 12:47832881-47832903 CCCCCAGCAGGGCCCTCCTCTGG - Intronic
1096524299 12:52201341-52201363 TCTCCAGCTGGGGCTTCCTGAGG - Intergenic
1097675067 12:62591353-62591375 CCCCAAACAGGGGCTTCCTCAGG - Intronic
1098796331 12:74893035-74893057 AATCCTGCTGGTGCTTCCTCAGG - Intergenic
1099218134 12:79878604-79878626 CACACAGCTGGGGTGGCCTCAGG + Intronic
1099964776 12:89433910-89433932 CACCCAGATGGGGCTGTCACAGG + Intronic
1100123553 12:91396197-91396219 CACATAGCTGGGGATGCCTCAGG - Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101309230 12:103561236-103561258 CACAAAGCTGGGGCTTGCTCTGG - Intergenic
1103064453 12:117885483-117885505 CACCCTGCTGGGGTTATCTCTGG + Intronic
1104324852 12:127786255-127786277 ACCCCAGCTGGGGCTGCTTCTGG + Intergenic
1104905983 12:132213775-132213797 CAGCAAGCTGGGGCCTCCTCAGG - Intronic
1105606526 13:21930702-21930724 CCAGCAGCTGGGGCTTCCTGAGG - Intergenic
1109940747 13:69360785-69360807 CACACAGCTGGGGAGGCCTCAGG - Intergenic
1110792626 13:79602068-79602090 CACCCTGATGCTGCTTCCTCTGG - Intergenic
1110831238 13:80033618-80033640 CACACAGCTGGGGAAGCCTCAGG - Intergenic
1113384802 13:109839037-109839059 CAATCAGCTGGGTCGTCCTCTGG + Intergenic
1113734119 13:112664948-112664970 CTCGCAGCTGGGGCGTCGTCAGG + Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1115876467 14:37867376-37867398 CACTCAGCTGGGCTGTCCTCAGG + Intronic
1117546444 14:56797927-56797949 GGCCCAGCTGGGCCTGCCTCGGG - Intergenic
1119148899 14:72340403-72340425 TACGCATTTGGGGCTTCCTCTGG - Intronic
1120751594 14:88203209-88203231 GACACAGCAGTGGCTTCCTCCGG + Intronic
1121111475 14:91316041-91316063 CACCCAGCGGTGGCGGCCTCAGG - Intronic
1121317213 14:92969477-92969499 CACTCAGCTGGAGCGTTCTCAGG - Intronic
1121814090 14:96915768-96915790 CACACAGCTGGGGAAGCCTCAGG - Intronic
1122004187 14:98688577-98688599 CACCCAGCTGGGCCTAGCTAAGG - Intergenic
1122116043 14:99527745-99527767 CACCCAGCTGTGGCTCCCGGTGG - Intronic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1122448481 14:101784413-101784435 CACCTAGCTGGGGAGGCCTCAGG + Intronic
1122827570 14:104377640-104377662 CATACAGCGGGGGCTTCCCCAGG + Intergenic
1122895288 14:104753623-104753645 CACCCGCCTGGTGCTTTCTCAGG + Intronic
1122904902 14:104797136-104797158 GAGCCACCTGGGGCTCCCTCTGG + Intergenic
1125007785 15:34837486-34837508 CACTCAGCTGTGACTGCCTCTGG - Intergenic
1125721231 15:41846085-41846107 CAGCCAGCTGGGGCTGCACCAGG + Intronic
1127576104 15:60294275-60294297 CACACAGCTGGGGAGACCTCAGG + Intergenic
1128874135 15:71188352-71188374 CACCTAGATGGAGCTTCCTCTGG + Intronic
1129038109 15:72663186-72663208 CTCCCAGCTGGAGCTGCCTTTGG - Intronic
1129211781 15:74074045-74074067 CTCCCAGCTGGAGCTGCCTTTGG + Intronic
1129398622 15:75267039-75267061 CTCCCAGCTGGAGCTGCCTTTGG - Intronic
1129402230 15:75291315-75291337 CTCCCAGCTGGAGCTGCCTTTGG - Intronic
1129456248 15:75677440-75677462 CCCTCAGCTGGGGGTGCCTCAGG + Intronic
1129475775 15:75783772-75783794 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1129728904 15:77918317-77918339 CTCCCAGCTGGAGCTGCCTTTGG + Intergenic
1129839608 15:78735544-78735566 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1130166179 15:81461342-81461364 CACCCAGCTGAGGCTTCTCTAGG + Intergenic
1130959344 15:88649430-88649452 TGCCCAGCTGTGGCTGCCTCTGG + Intronic
1131721146 15:95170243-95170265 CAACCAGCTGGCGCTTCTGCTGG + Intergenic
1132995277 16:2819435-2819457 AACCCCTCTGGGGGTTCCTCTGG + Intronic
1132998760 16:2838704-2838726 CACCCAGCTGAGGGTGCCCCCGG + Intronic
1133040647 16:3058467-3058489 CACGGAGCTGGGGCTGCCCCCGG + Exonic
1134678535 16:16107626-16107648 GACCCAACTGGGACTTTCTCAGG - Intronic
1134979273 16:18594072-18594094 CACCCAGCTCTGGCATGCTCAGG - Intergenic
1136082267 16:27860025-27860047 CTCCCAGCAGGGGCTCCCTCTGG + Intronic
1136570667 16:31094697-31094719 CACCCAGCCAGGGCTCCCCCAGG + Exonic
1136995893 16:35187907-35187929 CACCCAGCTGGGCTTCCCCCTGG + Intergenic
1137392566 16:48093443-48093465 CTCCCAGCAGAGGCCTCCTCTGG + Intronic
1137561404 16:49504698-49504720 CACCCAGCTGAGGATGTCTCGGG - Intronic
1137830726 16:51540542-51540564 CACCAGGCTCGGGCTTTCTCAGG + Intergenic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1140308121 16:73822764-73822786 CTTCCAGCTGGGGCTTCTTCTGG - Intergenic
1141036819 16:80633715-80633737 GACCCCCCTAGGGCTTCCTCAGG + Intronic
1141175062 16:81713334-81713356 CACTCAGCGGCGCCTTCCTCAGG + Intergenic
1142109764 16:88325087-88325109 CATCCAGCTGCGGCATACTCAGG + Intergenic
1142131662 16:88434086-88434108 CAACCAGCCAGGGCTTCCTTGGG - Exonic
1142245994 16:88970284-88970306 CACCTGCGTGGGGCTTCCTCAGG + Intronic
1143714424 17:8756754-8756776 CACCCAGCTGTGACTATCTCAGG - Intronic
1144411422 17:15005681-15005703 CACCCAGCGTGTGCTTCCTTGGG + Intergenic
1144623884 17:16834609-16834631 CACCAAGACGGGGCCTCCTCAGG + Intergenic
1144882545 17:18438107-18438129 CACCAAGACGGGGCCTCCTCAGG - Intergenic
1145149689 17:20506279-20506301 CACCAAGACGGGGCCTCCTCAGG + Intergenic
1145312340 17:21707548-21707570 GCCCCAGCTGGGGCTTGCCCTGG + Intergenic
1147570139 17:41565300-41565322 CAGCCAGGTGGCTCTTCCTCTGG - Intergenic
1147578178 17:41614314-41614336 CACCAAGACGGGGCCTCCTCAGG + Intronic
1148124484 17:45229824-45229846 CGCCCAGCTGGGACTCCCCCAGG - Intronic
1148394888 17:47299919-47299941 CAGGCTGATGGGGCTTCCTCTGG - Intronic
1150530730 17:65978416-65978438 GACCGAGCTGGGCCTTGCTCCGG - Intronic
1150861651 17:68806800-68806822 CACCCAGCTGTGGTTTCTGCTGG + Intergenic
1151248856 17:72817875-72817897 CACACAGCTGGGGAGGCCTCAGG + Intronic
1151402344 17:73864120-73864142 CACCCAGCGGGAGCTTCTGCTGG + Intergenic
1151408816 17:73907258-73907280 CACACCTCTGGGGCTTGCTCTGG - Intergenic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1151975243 17:77480677-77480699 CACCCAGCAGGGGCAGCCACAGG - Intronic
1152034265 17:77862218-77862240 CAGCCACCTGGGGGCTCCTCGGG + Intergenic
1152255256 17:79235340-79235362 CAGCAAGCTGGGGCTGCCTGAGG + Intronic
1152392026 17:80008944-80008966 AACCCAGCTGGGTCTGCCCCAGG - Intronic
1157280827 18:46345300-46345322 CCCCCAGCTTGGTCTTCCCCGGG + Intronic
1157293384 18:46425379-46425401 CACCCACCCGGGGCTACCCCAGG - Intronic
1161797008 19:6393070-6393092 CACCGAGCGGCGGCTTCCCCGGG - Exonic
1161873242 19:6886805-6886827 CCCCCAGCTGGTGCTTTCTGGGG + Intergenic
1162076930 19:8194160-8194182 CAACAGGCTGGGGCATCCTCCGG - Intronic
1163233919 19:16020353-16020375 CACCCAACAGGGGCTGCCTGGGG - Intergenic
1166572064 19:43803351-43803373 CCACCTGCTGGGGCCTCCTCTGG - Intronic
1167422086 19:49409849-49409871 CCCCCAGCTGGGGCTTCAGATGG - Exonic
1168705359 19:58467465-58467487 CTCCCAGCTGCGGGTTCCGCTGG + Exonic
927392330 2:22609442-22609464 CTCCCAGCTTTGGCTTGCTCTGG + Intergenic
928398882 2:30964046-30964068 ACCCCATCAGGGGCTTCCTCTGG - Intronic
928438203 2:31269677-31269699 CACCCTCCAGGGGCTGCCTCAGG - Intergenic
928848944 2:35718228-35718250 CACGCAGCTGGGGAGCCCTCAGG - Intergenic
928987667 2:37196812-37196834 CACCCAGCTCCCGCTTCCCCCGG - Intronic
929090689 2:38214365-38214387 CATCCAGCTGGGGCTTCATCTGG - Intergenic
929575900 2:43051477-43051499 CACCCAGCTGGGGCTTGTGAGGG - Intergenic
930740746 2:54830534-54830556 CACACAGCGGGGGCTTCATGAGG - Intronic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
932447100 2:71787751-71787773 CACCCAGCCAGGGCTTGCTGTGG - Intergenic
932592079 2:73073654-73073676 CCCCCTACTGGGGATTCCTCTGG - Exonic
932856373 2:75237697-75237719 CACCCAGCTGAGGCTGCTCCAGG + Intergenic
933639274 2:84741753-84741775 CACCCAGCTGAGGCTGCACCAGG + Intronic
937244272 2:120482485-120482507 CACCAGGGTGGGACTTCCTCGGG + Intergenic
937440169 2:121908521-121908543 CATCCGGCTGGGTCTTTCTCAGG + Intergenic
938101577 2:128501279-128501301 CACACAGCCGGGGCCTCCTTGGG - Intergenic
940003802 2:148993224-148993246 CACCCCACTGGGCCCTCCTCTGG - Intronic
940361720 2:152803333-152803355 CACACAGCTGGGGAGGCCTCAGG + Intergenic
942078552 2:172379623-172379645 CACACAGCTGGGGAGGCCTCAGG + Intergenic
944916702 2:204368337-204368359 GACCCAGATGAGGCTTCCTTCGG - Intergenic
946177224 2:217929189-217929211 CACCCAGATGGGCCTACCCCAGG + Intronic
946332542 2:219018477-219018499 CACTAAGCTGGGGCTCCGTCAGG + Intronic
946708875 2:222486187-222486209 TAGCCAGCTGAGGCTACCTCTGG + Intronic
946986872 2:225283138-225283160 CTCCAAGCTGAGGCTACCTCTGG + Intergenic
947341438 2:229143853-229143875 CACACAGCTGGGGAGGCCTCCGG - Intronic
948156913 2:235790819-235790841 CACCGAGCTGGGACCTCTTCTGG - Intronic
948160832 2:235822735-235822757 CTCCCAGCTCGGGCTCACTCAGG - Intronic
948836411 2:240628194-240628216 CCCCCAGCGGGGGCTGCCACAGG + Intronic
1172633526 20:36394315-36394337 CATCCAGCCAGCGCTTCCTCAGG - Intronic
1172694534 20:36812998-36813020 CCCCCAGCTGGGGCTGGGTCTGG - Intronic
1173169756 20:40714373-40714395 CACCCTGATGGGCCATCCTCGGG + Intergenic
1174462145 20:50690711-50690733 CGCCCAGCTGCTGTTTCCTCAGG + Intronic
1174697416 20:52574212-52574234 CACACAGCTGGGGAGGCCTCAGG + Intergenic
1175283427 20:57820722-57820744 CACCGAGCTGGCACCTCCTCGGG - Intergenic
1175688946 20:61051978-61052000 AACCCAGAAGAGGCTTCCTCAGG + Intergenic
1175784779 20:61705598-61705620 CACCCTCATGGGACTTCCTCTGG + Intronic
1175984841 20:62759474-62759496 CACCCAGCCTGGGCTTCTTTAGG - Intronic
1176121840 20:63457607-63457629 CAGCCAGCTGTGGCTCCCTCGGG + Intronic
1176243554 20:64086087-64086109 CACCCAGCAGCCGCTTTCTCTGG + Intronic
1177212365 21:18087089-18087111 CACCCAGCTGGGGGATCGACAGG - Intronic
1178396135 21:32245529-32245551 TTCCCAGCTGCAGCTTCCTCTGG - Intergenic
1180791744 22:18578492-18578514 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1181052893 22:20246090-20246112 CAGCCAGCAGGGCCATCCTCCGG - Intronic
1181229992 22:21416817-21416839 CAACCAGCCCGGGCTTCCCCAGG + Intergenic
1181248657 22:21518049-21518071 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1181368428 22:22397817-22397839 AATCCAGCTGGGTCTGCCTCAGG + Intergenic
1181403162 22:22664028-22664050 CACACAGCAGGGGTTTCCACGGG + Intergenic
1181407839 22:22697491-22697513 CACCCAGCAGAGGTTTCCACGGG + Intergenic
1181420121 22:22792073-22792095 CACCCAGCAGAGGTTTCCACGGG + Intronic
1181424170 22:22822359-22822381 CACCCAGCAGAGGCTTCCAGTGG + Intronic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181597588 22:23926714-23926736 CACCCCTCTGGGGCTACCTGAGG + Intergenic
1181714394 22:24713591-24713613 CACTCAGGTGGCTCTTCCTCAGG - Intergenic
1181901970 22:26163525-26163547 ACCCCAGCTGGGCTTTCCTCTGG + Intergenic
1182092269 22:27603967-27603989 CAGCCAGCTGGGGCCTGGTCTGG - Intergenic
1182572884 22:31251987-31252009 CATCCAGCCAGGCCTTCCTCAGG + Intronic
1184095826 22:42315754-42315776 CCTCCACCTGGGGCTACCTCTGG - Intronic
1184240693 22:43209999-43210021 CACGCAGCTGAGGCTGCCTCTGG + Intronic
1184492996 22:44820810-44820832 CACACAGCTCGGCCTCCCTCGGG + Intronic
1184521605 22:44997821-44997843 CACCCAGGGGCGGCCTCCTCAGG + Intronic
1184600751 22:45541954-45541976 CAGCCAGGTAGGGCTGCCTCTGG + Intronic
1184767992 22:46581978-46582000 CACCCACCTGGGCCTCCCTGTGG - Intronic
1184784260 22:46664211-46664233 CCCCCAGGTGGCACTTCCTCAGG + Intronic
1184887168 22:47353559-47353581 CACCCAGCAGGGGAATCCACTGG - Intergenic
950538393 3:13594996-13595018 CACCCAGCCGGGGCAGCCGCAGG - Intronic
952852582 3:37741203-37741225 CACCCTGCTGAGGCTTTCTCTGG + Intronic
954701420 3:52452796-52452818 CACCCAGCTTGAGTTTCATCAGG - Intronic
956811455 3:72867652-72867674 CTCCCAGTTTGGCCTTCCTCAGG + Intergenic
960486060 3:118254269-118254291 CAGCCAGTTTGGGCTTCCTGAGG - Intergenic
962235316 3:133701896-133701918 GACCTACCTGGGGCTTCCTTTGG + Intergenic
963171593 3:142256791-142256813 CTCCCAGCTGTGTCTTTCTCTGG - Intergenic
964445145 3:156750609-156750631 AACCCAGCTGAGGCTTGCCCAGG - Intergenic
964669579 3:159210057-159210079 CACCCAACTGTCCCTTCCTCTGG - Intronic
965752375 3:171989673-171989695 CACCCAGTTGTGGCAGCCTCGGG - Intergenic
967509282 3:190291337-190291359 CACACAGCTGGGGAGACCTCAGG + Intergenic
969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG + Intergenic
969300110 4:6292517-6292539 CACTGAGCTGGGGGTGCCTCTGG + Intronic
969320826 4:6411439-6411461 CACGGAGCAGGGGCTTCCTAGGG - Intronic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969595966 4:8149463-8149485 GACCAAGCTGGGGTTTCCTGTGG - Intronic
969670077 4:8585304-8585326 CACCCAGCTGAGGCTGTGTCTGG - Intronic
970093032 4:12431011-12431033 CACCCACTTGTGGCTGCCTCAGG - Intergenic
971795179 4:31217721-31217743 CACACAGCTGGGGAGACCTCAGG + Intergenic
977678609 4:99774340-99774362 CACCAGGCTGGGGCTCCCTGTGG + Intergenic
978334517 4:107651513-107651535 CACACAGCTGGGGAGGCCTCAGG + Intronic
985727462 5:1523703-1523725 CACCCACCTGGGCCTTCTGCAGG + Exonic
985763325 5:1763067-1763089 AACCCAGCAGGTGCTTCCTGAGG - Intergenic
985967936 5:3351916-3351938 CACCAAGCAGGGGCAGCCTCAGG + Intergenic
987091187 5:14509076-14509098 CCACCACCTGGGGCTTCCTCTGG + Exonic
989108972 5:37889065-37889087 CAACCTGCTGTGGCTGCCTCTGG + Intergenic
992723394 5:79582379-79582401 CAATCAGCTGTGGCTCCCTCTGG - Intergenic
994093103 5:95825851-95825873 GACCCACCTGGGGATTCCTTAGG + Intergenic
995084910 5:108097251-108097273 CACACAGCTGGGGAGGCCTCAGG - Intronic
996693903 5:126371537-126371559 CACCGAGCTGGGGCTGTCTGTGG - Intronic
999191655 5:149752401-149752423 CAGGCAGCTGGGTCTTCCTGGGG - Intronic
999247353 5:150162250-150162272 CACCCAGCCAGGGCCTCCTGGGG - Intergenic
999258368 5:150222461-150222483 TGCCAGGCTGGGGCTTCCTCAGG - Intronic
999275385 5:150326431-150326453 CATTCACCTGGGGCTTACTCTGG + Intronic
1000381001 5:160629240-160629262 CAGCCACCTGGGGCTGCCACAGG + Intronic
1001034553 5:168288368-168288390 CACCCTCCTGGGGCTGCGTCTGG - Intergenic
1001221208 5:169902592-169902614 CACCCCGCTGAGGCTCCCTGGGG + Intronic
1001778152 5:174344611-174344633 CACCCAGCTCTGCCCTCCTCTGG - Intergenic
1002180346 5:177427998-177428020 CACCCAGCTGAAAGTTCCTCTGG - Intronic
1002436354 5:179234270-179234292 CACCCAGGTGGGCAGTCCTCAGG + Intronic
1003805294 6:9721294-9721316 GATCCATCTGGGGCTTCTTCTGG - Intronic
1004516384 6:16325597-16325619 GACCCACCTGGGGCTTCCCCAGG + Intronic
1006936710 6:37723676-37723698 TACCGACCTGGGGCTTCCTGAGG - Intergenic
1007243297 6:40442474-40442496 CAGCCAACTGGGGCTCCCTGAGG + Intronic
1007578758 6:42942725-42942747 CACCCAGCAGCAGCTTACTCTGG + Intergenic
1008072590 6:47112934-47112956 CTCCCCGCTGGGGCATCTTCAGG - Intergenic
1012818722 6:104057798-104057820 CCCCCAACTGGGGCCTCCCCAGG - Intergenic
1013075147 6:106764555-106764577 CACCCAGCTGTGTCTCTCTCTGG - Intergenic
1013619242 6:111872766-111872788 CACCCCGCAGGGGTGTCCTCCGG + Intronic
1015796399 6:137016238-137016260 CACCCAGCTGGGGCTCCATGGGG + Intronic
1019058439 6:169239288-169239310 CTCTCAGCTGGGGCTCCATCGGG + Intronic
1019612938 7:1946041-1946063 CAACCCGCTGGCCCTTCCTCTGG - Intronic
1022047974 7:26638535-26638557 TACCCAGCAGGGGCTTCCTAAGG - Exonic
1022628128 7:32059407-32059429 GCCCCAGGTGGGGCTTCCTGTGG - Intronic
1024675313 7:51632828-51632850 CACACAGCTGGGGAGGCCTCAGG - Intergenic
1025023781 7:55499497-55499519 TCCCCAGCAGGGGTTTCCTCTGG - Intronic
1025040928 7:55645214-55645236 GACCCGGCTGAGGCTTCTTCTGG + Intergenic
1029851341 7:103464697-103464719 CATCCACCTGGGCCTTCTTCAGG - Intergenic
1032280007 7:130492421-130492443 GTCCGAGCTGGGGCTGCCTCTGG + Intronic
1033148402 7:138891247-138891269 CAACCGGCTGGAGCTGCCTCAGG - Intronic
1033332504 7:140428185-140428207 CACTCACCTGGGGCTTCCGGAGG + Intergenic
1034091489 7:148368371-148368393 CTCCCAGCTGAGGCCTCCCCTGG + Intronic
1034268189 7:149791220-149791242 CAGCCAGCGGGGCCTCCCTCAGG - Intergenic
1034472472 7:151262767-151262789 CACCCAGTTGGGGCTTTCCCTGG - Intronic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1035391635 7:158508306-158508328 CAGTCAGCGGGGGCTTCCACAGG + Intronic
1036047338 8:5158777-5158799 GACACAGATGGGGCGTCCTCAGG - Intergenic
1036218006 8:6896869-6896891 CACCCAGCCTGGCCTTCCACGGG - Intergenic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1037453495 8:19040326-19040348 CAAGCAGCTGGGGCTACCACAGG + Intronic
1037817052 8:22117867-22117889 CACCCAGCTGGGACTCCCCTAGG - Intronic
1037906442 8:22718564-22718586 CACCCAGCTGGGGCCATCCCGGG - Intronic
1038748387 8:30273940-30273962 CACATGGCTGGGGCTGCCTCAGG - Intergenic
1039229463 8:35427346-35427368 AACCCACCTGGGGCTACCTTGGG + Intronic
1041826145 8:62098249-62098271 CTCCAAGCTCTGGCTTCCTCAGG + Intergenic
1043267034 8:78279335-78279357 CCTCCAGCTGGCACTTCCTCTGG - Intergenic
1043476632 8:80611641-80611663 CACCCGCCTGGCGCCTCCTCCGG + Intergenic
1044533843 8:93337745-93337767 GAGCCAGGTGGGGCTGCCTCTGG - Intergenic
1045659533 8:104422822-104422844 CACCCAGCAGGGGCCTGCCCAGG - Intronic
1045851208 8:106700423-106700445 CATACAGCTGGGGCTTTCTGCGG - Intronic
1048121249 8:131583919-131583941 CACATAGCTGGGGATTCCTCAGG + Intergenic
1048236046 8:132691839-132691861 CAGCCACATGGGCCTTCCTCTGG - Intronic
1048613653 8:136051030-136051052 CCCACAGCTGGGGGTGCCTCAGG - Intergenic
1049016013 8:139920568-139920590 CACACAGCTGGGGCTCCAACAGG + Intronic
1049352595 8:142172054-142172076 TACCCAGCTGGGGCACCCACAGG + Intergenic
1049598419 8:143495465-143495487 CTCAGAGCTGGGGCTGCCTCTGG + Intronic
1052256656 9:26465404-26465426 CACACAGCTGGGGAGGCCTCAGG + Intergenic
1054930620 9:70631168-70631190 CACCCGGTAGGGGCTTCATCTGG + Intronic
1057306615 9:93916172-93916194 GACCCAGCTGCAGCTTCCCCAGG - Intergenic
1057385697 9:94604341-94604363 CATCCAGCTGTAGCTGCCTCGGG - Intronic
1057810134 9:98251165-98251187 ATCCCAGCTGAGGCTGCCTCGGG + Intronic
1059108276 9:111530605-111530627 CACCCAGCTGGTGCCTGCTGGGG + Intronic
1059269171 9:113061335-113061357 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059270306 9:113066784-113066806 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059271442 9:113072234-113072256 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059272573 9:113077678-113077700 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059273708 9:113083120-113083142 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059274843 9:113088566-113088588 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1060327819 9:122634444-122634466 CACACAGCTGGGGAGCCCTCAGG + Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1062023231 9:134328967-134328989 CAGGAAGCTGGGGCTGCCTCTGG - Intronic
1062586676 9:137252760-137252782 CACCCACCTAGGGCTGCCTGGGG + Exonic
1186994707 X:15107621-15107643 CACACAGCTGGGGTATCCTTTGG - Intergenic
1187048883 X:15676132-15676154 CAGCAAGCTGGGACTCCCTCGGG + Intergenic
1192168912 X:68842546-68842568 CACCTAGCTGGGGCTAGATCTGG + Intergenic
1199330470 X:146552393-146552415 AACACAGCTGGGGATGCCTCAGG + Intergenic
1200034516 X:153319082-153319104 CTCCCAGCTGGGACCTCCTGGGG + Intergenic
1201762730 Y:17557677-17557699 CACCCCTCTGTGCCTTCCTCTGG - Intergenic
1201838822 Y:18348312-18348334 CACCCCTCTGTGCCTTCCTCTGG + Intergenic