ID: 1181464545

View in Genome Browser
Species Human (GRCh38)
Location 22:23103834-23103856
Sequence CTGGCTACACAGGTCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181464545_1181464552 -6 Left 1181464545 22:23103834-23103856 CCCTGGAGGACCTGTGTAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1181464552 22:23103851-23103873 AGCCAGGGCTGGCCTCAGGCTGG 0: 1
1: 0
2: 2
3: 81
4: 585
1181464545_1181464555 19 Left 1181464545 22:23103834-23103856 CCCTGGAGGACCTGTGTAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1181464555 22:23103876-23103898 TCCCCAGTGCCTACAAATGCTGG No data
1181464545_1181464551 -10 Left 1181464545 22:23103834-23103856 CCCTGGAGGACCTGTGTAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1181464551 22:23103847-23103869 GTGTAGCCAGGGCTGGCCTCAGG 0: 1
1: 0
2: 2
3: 37
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181464545 Original CRISPR CTGGCTACACAGGTCCTCCA GGG (reversed) Intronic
900098006 1:948179-948201 CTGGCTGTGCAGGTACTCCAGGG + Exonic
903086507 1:20864518-20864540 CAGGCGACACAGGCACTCCAGGG + Exonic
903358603 1:22763128-22763150 CAGGCAGCTCAGGTCCTCCATGG - Intronic
904328341 1:29741970-29741992 CTGGGCATCCAGGTCCTCCAGGG - Intergenic
904831022 1:33306873-33306895 CTGGCTGCACAAGCCCGCCAAGG - Exonic
905375732 1:37518848-37518870 TTGGACACACAGGTTCTCCAAGG - Intergenic
905584292 1:39105192-39105214 CTGCCCACACGGGTCCCCCAGGG - Intronic
905635316 1:39547186-39547208 CTGGCTAGCCAGTTCCTCAAGGG - Intergenic
910609631 1:89127604-89127626 TTGGACACACAGGTTCTCCAAGG + Intronic
912116509 1:106413884-106413906 CTGCCAACATAGGACCTCCAAGG + Intergenic
913160945 1:116146158-116146180 ATGGACACAAAGGTCCTCCAAGG + Intergenic
915895530 1:159808618-159808640 CTGGCTACATGTGTCCCCCATGG - Intronic
915920751 1:159973602-159973624 CTGGCTACATGTGTCCCCCATGG + Intergenic
918234227 1:182562691-182562713 CTAGTTACACAGGGGCTCCAGGG + Intergenic
919092014 1:192987547-192987569 ATGGACACACAGGTTCTCCAAGG - Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
922370043 1:224900899-224900921 CTGCTTTCACAGGACCTCCAAGG + Intronic
923747053 1:236711102-236711124 CTGGCTATACAGGCCTTCCCTGG - Intronic
923929954 1:238684198-238684220 GTGGACACACAGGTTCTCCAAGG + Intergenic
1067993571 10:51243360-51243382 CTGGCTTCACAGCTATTCCAGGG - Intronic
1068863302 10:61868516-61868538 TTGGACACACAGGTTCTCCAAGG - Intergenic
1071388109 10:85142037-85142059 ATGGACACACAGGTTCTCCAAGG - Intergenic
1073539317 10:104305595-104305617 ATGGTTACACATGTGCTCCAGGG + Intergenic
1074249079 10:111725663-111725685 CTGCCTAAACAGGTCCACCGAGG + Intergenic
1074615794 10:115066826-115066848 CTGACCACACTAGTCCTCCATGG + Intergenic
1074756790 10:116629701-116629723 GAGGCTACCCAGATCCTCCACGG + Intronic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1078484186 11:11706490-11706512 CTCTCTACCCAGGTCCTCCCTGG + Intergenic
1078929124 11:15899935-15899957 CTGACTTAACAGGTCCCCCAAGG + Intergenic
1079726119 11:23883195-23883217 CTGGACACAAAGGTTCTCCAAGG + Intergenic
1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG + Intergenic
1081716489 11:45254202-45254224 CTGCCTGCACAGCTTCTCCAGGG + Intronic
1083696341 11:64445304-64445326 CTGGCTAGGCAGGTCTGCCAGGG - Intergenic
1085294560 11:75423842-75423864 CAGGCTCCACCGGTCCTCCTTGG + Exonic
1086392046 11:86375186-86375208 CTGCCTGCCCAGGTCCTGCAGGG - Exonic
1087321206 11:96660995-96661017 CTGGTTACACAGTGCCTGCAAGG - Intergenic
1088828449 11:113515406-113515428 CTGGATTCTGAGGTCCTCCAGGG - Intergenic
1090519167 11:127460349-127460371 CTGGCTTCACAGTTGCTTCAAGG - Intergenic
1094661400 12:32473046-32473068 TTGGACACACAGGTTCTCCAAGG - Intronic
1096592780 12:52672782-52672804 CTGGCTGCTCAGGGCCTCCATGG - Intergenic
1100521568 12:95380312-95380334 TTGGACACACAGGTTCTCCAAGG - Intronic
1102420648 12:112800441-112800463 CTGGTTAGACAGGACCTCCCAGG + Intronic
1102697970 12:114814958-114814980 CTTGCTACACAGTTTCTCCCCGG - Intergenic
1104952438 12:132447594-132447616 CTGTCTAGACAGGTCCTCGCAGG - Intergenic
1105722300 13:23128487-23128509 TTGGACACACAGGTTCTCCAAGG - Intergenic
1110417589 13:75269162-75269184 TTGGACACACAGGTTCTCCAAGG - Intergenic
1111893713 13:94115232-94115254 GTGGCTGCAAATGTCCTCCAGGG + Intronic
1113678152 13:112222313-112222335 TTGGACACACAGGTTCTCCAAGG - Intergenic
1113838863 13:113347331-113347353 TTGGCCACAGAGGTCCTCCCGGG - Intronic
1113838950 13:113347717-113347739 TTGGCCACAGAGGTCCTCCCGGG - Intronic
1113838977 13:113347835-113347857 TTGGCCACAGAGGTCCTCCCGGG - Intronic
1113838991 13:113347895-113347917 TTGGCCACAGAGGTCCTCCCGGG - Intronic
1113881410 13:113628803-113628825 CTGCCCACACACGCCCTCCAGGG + Intronic
1113933488 13:113981017-113981039 GTGGGTACCCAGGTCCACCATGG - Intronic
1122294530 14:100697876-100697898 CGGGTTACACAGCTCATCCAAGG + Intergenic
1123995469 15:25715307-25715329 CTGGCTCCAAATGTCCTCGAAGG + Intronic
1126952788 15:53900573-53900595 GTAGCTACACAATTCCTCCAAGG + Intergenic
1127475552 15:59329189-59329211 CTGGGAAGACAGCTCCTCCATGG + Intronic
1129155279 15:73713735-73713757 CTGGTCACACTGGTTCTCCAGGG + Exonic
1129454732 15:75670602-75670624 CTGGCTGCCCTGCTCCTCCATGG + Intergenic
1132940070 16:2502036-2502058 CTGGCCACACAGCACCTCCTTGG + Exonic
1135071152 16:19353000-19353022 CTGCCAACACAGGTCTTCCGTGG - Intergenic
1136251759 16:29009776-29009798 CTGGCATCAGGGGTCCTCCAAGG + Intergenic
1138572794 16:57886369-57886391 CTGACTAGACAGGAACTCCAAGG - Intronic
1139442000 16:66973033-66973055 CTGGCCTCAGAGGTCCTCCTGGG - Exonic
1142807799 17:2380576-2380598 CCGCATACACAGCTCCTCCAAGG - Exonic
1143204969 17:5134945-5134967 TTGGGTGCACAGTTCCTCCATGG - Intronic
1144669390 17:17124451-17124473 ATGGATACACAGCTCATCCAGGG + Intronic
1144723324 17:17487109-17487131 TTGGACACACAGGTTCTCCAAGG - Intronic
1146160699 17:30557937-30557959 TTGGGTGTACAGGTCCTCCATGG - Exonic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148747750 17:49927861-49927883 CTGGGCCCCCAGGTCCTCCAAGG - Intergenic
1149652030 17:58281568-58281590 CTGGTTACACTGGTTATCCAGGG + Intergenic
1151584928 17:75003198-75003220 CCGCCTACACAGTTCCTCCCTGG + Exonic
1152772738 17:82180143-82180165 CTGGCCACGCAGCCCCTCCAGGG - Intronic
1152903229 17:82957053-82957075 CTGGCTCCTCGGGGCCTCCAGGG - Intronic
1154010677 18:10571635-10571657 CTGCCTGCTCAGGGCCTCCATGG - Intergenic
1154486635 18:14877045-14877067 CTGGCTCTGCAGGTCCTCCAGGG - Intergenic
1154491630 18:14926423-14926445 CTGCCCACACAGGTCATCAAGGG - Intergenic
1155549753 18:26952494-26952516 CTGGATGGACTGGTCCTCCAGGG - Intronic
1155852391 18:30789202-30789224 TTGGACACACAGGTTCTCCAAGG - Intergenic
1156552688 18:38034173-38034195 CTGGACTCTCAGGTCCTCCAAGG + Intergenic
1157086089 18:44581531-44581553 TTGGACACACAGGTTCTCCAAGG - Intergenic
1160987516 19:1846023-1846045 ATGGCCCCACAGGTGCTCCAGGG + Intronic
1162578620 19:11514084-11514106 CTGCCCAAACAGGTCCTCAAAGG + Exonic
1167246056 19:48373810-48373832 CTGGCTCCCCAGGGCCTCCCGGG + Intronic
1168613778 19:57821465-57821487 CTGGCTTCAGAGATTCTCCAGGG - Intronic
1168617765 19:57852170-57852192 CTGGCTTCAGAGATTCTCCAGGG - Intronic
925345232 2:3167387-3167409 CGGGCTGCACAGGACCTGCACGG + Intergenic
928915138 2:36462598-36462620 TTGCCTACACACGTGCTCCAGGG - Intronic
929233810 2:39585952-39585974 TTGGACACACAGGTTCTCCAAGG - Intergenic
929963255 2:46512344-46512366 CTGGATAAACTGGTGCTCCAGGG - Exonic
931229497 2:60362375-60362397 CTGGCCTCCCAGGTCCTCCCTGG - Intergenic
932521917 2:72422782-72422804 TTGGACACACAGGTTCTCCAAGG - Intronic
933001619 2:76931635-76931657 CTGGATACACATGTTCTCTATGG + Intronic
935153438 2:100460860-100460882 CAGGCTCCCCAGGTCCTGCAGGG - Intergenic
935896738 2:107747063-107747085 CTAGATACAAAGGTTCTCCAAGG + Intergenic
937551273 2:123095355-123095377 CTGACTCCACAGGTCCTCATGGG - Intergenic
938303289 2:130230957-130230979 CTGGCTGTGCAGGTACTCCAGGG - Intergenic
938453383 2:131443280-131443302 CTGGCTGTGCAGGTACTCCAGGG + Intergenic
938796223 2:134719593-134719615 CTGGCTAAATGGGTGCTCCAGGG - Intergenic
942220400 2:173763396-173763418 CTGGCAACCCAGGCCTTCCATGG + Intergenic
942644241 2:178093794-178093816 CTGGCTCCCCTGGTCCTCCATGG - Intronic
945215927 2:207434023-207434045 GTGGGTCCTCAGGTCCTCCATGG - Intergenic
946345780 2:219109390-219109412 CTGGCAACAAAGGTGCCCCATGG + Intronic
946355554 2:219182272-219182294 GTGTCTCCACTGGTCCTCCAGGG - Exonic
946467781 2:219927861-219927883 CTGGATACACAGGGCATCCTTGG + Intergenic
946599835 2:221347713-221347735 CTGGGTACCCACATCCTCCAAGG - Intergenic
948544161 2:238714516-238714538 CTGTCTACACAGAAACTCCAAGG + Intergenic
1170194407 20:13675509-13675531 CCTTCTACACAGCTCCTCCATGG + Intergenic
1172448130 20:35003668-35003690 ATGGCTACCCAGGTTCACCAGGG - Intronic
1173013521 20:39204235-39204257 CAGGCTACACAATTCCTCCCAGG + Intergenic
1173195791 20:40911780-40911802 TTGGATACACAGGTTCTCCAAGG - Intergenic
1175061675 20:56249163-56249185 CTGGATAAACTGGTCCTCGAAGG - Exonic
1176117446 20:63439251-63439273 CTGGTGACACAGGTCCCTCATGG - Intronic
1176718315 21:10373055-10373077 CTGGCTGCATGGGTCCCCCATGG + Intergenic
1176794667 21:13362334-13362356 CTGGCTCTGCAGGTCCTCCAGGG + Intergenic
1176899036 21:14417473-14417495 CTGGCCACTCAGGTCCTGGAGGG - Intergenic
1176966501 21:15218179-15218201 TTGGACACACAGGTTCTCCAAGG + Intergenic
1177497046 21:21903181-21903203 ATGGACACACAGGTTCTCCAAGG - Intergenic
1178973829 21:37205163-37205185 CTGGCCACACCGATGCTCCAGGG - Intergenic
1180299538 22:11025962-11025984 CTGGCTGCATGGGTCCCCCATGG + Intergenic
1180994019 22:19955563-19955585 CTCGGCACACAGGTCCCCCACGG - Intronic
1181464058 22:23101391-23101413 CTGGCTACACAGCAGCTCCAAGG - Intronic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1182665652 22:31957629-31957651 CTGGTTAAACAGTTCCTCGAGGG - Intergenic
1183402667 22:37613777-37613799 CCGGCTACACAGCTCCTTGAGGG + Intronic
1183685337 22:39358196-39358218 TTGGACACACAGGTTCTCCAAGG - Intronic
949977875 3:9477277-9477299 CTGGCTCCAGGGCTCCTCCAGGG - Exonic
951105535 3:18737746-18737768 CTGGCTACAAAGCTGCTTCATGG + Intergenic
952398364 3:32940556-32940578 TTGGACACACAGGTTCTCCAAGG - Intergenic
953091797 3:39734733-39734755 ATGGGTACACAGGTCATTCACGG - Intergenic
954826857 3:53381113-53381135 CAGGATACACAGATTCTCCAAGG + Intergenic
955449580 3:59051453-59051475 TTGGACACACAGGTTCTCCAAGG - Intergenic
956511789 3:70000959-70000981 ATGGCAACACAGCTTCTCCAGGG - Intergenic
961337490 3:126190453-126190475 GTGGCTATCCAGGGCCTCCATGG + Intronic
962357553 3:134707927-134707949 CTGGCCACACATATCCTCAAGGG + Intronic
962764291 3:138547137-138547159 TTGGCTGCAGAGGTCCTCCCTGG - Intronic
967681973 3:192374314-192374336 ATGACTACACAGGTGATCCATGG - Intronic
968520509 4:1032818-1032840 CTGTCTCCAAAGGTCCTTCAGGG - Intergenic
969483637 4:7459792-7459814 CTGGCTTCACAGGACCCTCAAGG - Intronic
969874473 4:10125647-10125669 TTGGCTTCACAATTCCTCCACGG - Intergenic
970431085 4:15989888-15989910 CTGGCTACACAGGGCCCCTGAGG - Intronic
973176449 4:47212170-47212192 CCAGCTACGCAGATCCTCCAAGG + Intronic
973308181 4:48675981-48676003 TTGGACACACAGGTTCTCCAAGG - Intronic
975055505 4:69924529-69924551 GTGGACACAAAGGTCCTCCAAGG - Intergenic
976646767 4:87395668-87395690 TTGGACACACAGGTTCTCCAAGG + Intergenic
977750847 4:100608409-100608431 TTGGACACACAGGTTCTCCAAGG + Intronic
980628721 4:135407454-135407476 TTGGACACACAGGTTCTCCAAGG - Intergenic
980977230 4:139623143-139623165 CTGGCCACACTGCTCCTCCAGGG - Intergenic
983026216 4:162740299-162740321 ATGGACACACAGGTTCTCCAAGG - Intergenic
984662372 4:182387326-182387348 TTGGACACACAGGTTCTCCAAGG - Intronic
985087195 4:186325141-186325163 GTGGACACACAGGTTCTCCAAGG - Intergenic
987315417 5:16718828-16718850 TTGGACACACAGGTTCTCCAAGG - Intronic
987383911 5:17311577-17311599 ATGGACACACAGGTTCTCCAAGG + Intergenic
988279423 5:29127028-29127050 ATGGACACACAGGTTCTCCAAGG + Intergenic
990890137 5:60639780-60639802 CTGGCTACACTGTTCCTCATGGG - Intronic
991940069 5:71842062-71842084 CTGGTAACACAGGGCCTCCTTGG + Intergenic
992034128 5:72754625-72754647 CTGCCCAGACAGGTCCTGCATGG - Intergenic
992504123 5:77368586-77368608 CTCACTACACAGGTCATCCCAGG + Intronic
993137952 5:83993855-83993877 CTGTATACCCAGGTCTTCCAAGG + Intronic
994215466 5:97132508-97132530 CTCCCTACACAGTTCCTCAATGG - Intronic
994509712 5:100688429-100688451 TTGGACACACAGGTTCTCCAAGG + Intergenic
995025940 5:107422709-107422731 CTGGCCAGCAAGGTCCTCCATGG - Intronic
1000311311 5:160047668-160047690 CTGGCCAGGAAGGTCCTCCATGG + Intronic
1001206802 5:169771074-169771096 GTGGCTACACAGGTCCACTTCGG - Intronic
1001227405 5:169956917-169956939 CTGGCTCTGCAGGCCCTCCAGGG - Intronic
1001535276 5:172493660-172493682 ATGGCTTCACAGGTTGTCCAAGG - Intergenic
1001855919 5:175010701-175010723 CTGGCTACACATGTTCTCCAAGG + Intergenic
1002097076 5:176837698-176837720 CTAGCTACACAGCCCATCCATGG - Intronic
1003060858 6:2861017-2861039 TTGGACACACAGGTTCTCCAAGG - Intergenic
1003717804 6:8666566-8666588 CTAGACACACAGGTTCTCCAAGG - Intergenic
1003736999 6:8887763-8887785 TTGGACACACAGGTTCTCCAAGG - Intergenic
1003862895 6:10338009-10338031 TTGGACACACAGGTTCTCCAAGG - Intergenic
1004906819 6:20244373-20244395 TTGGACACACAGGTTCTCCAAGG + Intergenic
1005035378 6:21551249-21551271 TTGGACACACAGGTTCTCCAAGG + Intergenic
1005696986 6:28360646-28360668 CTGGCCACACAGGTCCTCTGAGG - Intronic
1005976909 6:30807204-30807226 TTGGACACACAGGTTCTCCAAGG + Intergenic
1006008446 6:31021638-31021660 ATGGACACAGAGGTCCTCCAAGG - Intronic
1006477934 6:34269624-34269646 TTGGACACACAGGTTCTCCAAGG - Intergenic
1010199212 6:73268636-73268658 GTGGATACAAAGGTTCTCCAAGG + Intronic
1014573708 6:123044210-123044232 CTGGCTACACAGTTCTTCACTGG - Intronic
1015600468 6:134905488-134905510 ATGGACACACAGGTTCTCCAAGG - Intergenic
1017822049 6:158056635-158056657 CAGGCTGCCCAGGTCCTCGATGG + Intronic
1019000161 6:168743505-168743527 ATGGACACACAGGTTCTCCAAGG + Intergenic
1019623077 7:2002083-2002105 CTGGCCTCCCAGCTCCTCCAGGG + Exonic
1020125952 7:5532574-5532596 GTGGCAACACAGGTCCTGCCTGG - Intronic
1024561277 7:50647643-50647665 CTGGCTAAGAAGGTCCTCAAAGG + Intronic
1026874646 7:73872220-73872242 CTGGCTGCCCACGTCCTCCTGGG + Intergenic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1028663135 7:93306664-93306686 CTTGCTTCACAGTTCCTGCATGG + Intronic
1031439993 7:121782359-121782381 CTGGCTCCACAGGAGCTCCGGGG - Intergenic
1034167654 7:149038461-149038483 TTGGACACACAGGTTCTCCAAGG + Intergenic
1035122290 7:156578795-156578817 CTGGGTACACATCTCATCCATGG + Intergenic
1037425505 8:18750765-18750787 ATGGACACACAGGTTCTCCAAGG + Intronic
1037626254 8:20609641-20609663 ATGGCTACTCATGTCCACCAAGG + Intergenic
1037672723 8:21029135-21029157 CTGGCCACACAGGACCCCAAGGG + Intergenic
1037962121 8:23105473-23105495 CTGGCTCCTCTGTTCCTCCATGG - Intronic
1037977021 8:23221019-23221041 CTGGCTCCTCTGTTCCTCCACGG + Intronic
1037983628 8:23272714-23272736 CTAGATACAAAGGTTCTCCAAGG - Intronic
1040466123 8:47696955-47696977 CTGCCAACTCACGTCCTCCAGGG - Intronic
1041034548 8:53775544-53775566 TTGGACACACAGGTTCTCCAAGG + Intronic
1041095163 8:54342573-54342595 CTGGCTACACAGCCCCTTCTTGG + Intergenic
1045131827 8:99163002-99163024 TTGGACACACAGGTTCTCCAAGG + Intronic
1049500436 8:142960274-142960296 TTGGACACACAGGTTCTCCAAGG - Intergenic
1053887566 9:42655854-42655876 CTGGCTCTGCAGGTCCTCCAGGG - Intergenic
1054226588 9:62463304-62463326 CTGGCTCTGCAGGTCCTCCAGGG - Intergenic
1057724819 9:97561041-97561063 CTGGCTTCACAGGCCTTCCCTGG - Intronic
1057897071 9:98917737-98917759 CTGACTCCAGAGGGCCTCCAGGG + Intergenic
1058786609 9:108394270-108394292 TTGGACACACAGGTTCTCCAAGG - Intergenic
1060594111 9:124838338-124838360 ATGGATACAAAGGTTCTCCAAGG + Intergenic
1185593753 X:1294893-1294915 CTGTCTACACTGGGTCTCCATGG - Intronic
1185880397 X:3735148-3735170 CTGGAGTCCCAGGTCCTCCATGG + Intergenic
1190413823 X:50162693-50162715 TTGGACACACAGGTTCTCCAAGG + Intergenic
1196714760 X:118800070-118800092 TTGGATACACAGGTTCTCCAAGG - Intergenic
1196728839 X:118921747-118921769 TTGGACACACAGGTTCTCCAAGG + Intergenic
1196775329 X:119332750-119332772 TTGGAAACACAGGTTCTCCAAGG - Intergenic
1196793847 X:119487235-119487257 TTGGACACACAGGTTCTCCAAGG + Intergenic
1200785390 Y:7256165-7256187 CTGGAGTCCCAGGTCCTCCATGG - Intergenic