ID: 1181464622

View in Genome Browser
Species Human (GRCh38)
Location 22:23104191-23104213
Sequence GTCCTCCGTCATCCCGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181464622_1181464628 5 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464628 22:23104219-23104241 GGTGTAAGGTCTAAGCAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 91
1181464622_1181464631 18 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464631 22:23104232-23104254 AGCAGGCAGGGCAAGGTCGCAGG No data
1181464622_1181464627 1 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464627 22:23104215-23104237 AGGCGGTGTAAGGTCTAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1181464622_1181464625 -9 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464625 22:23104205-23104227 ACGGAGGACCAGGCGGTGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 68
1181464622_1181464629 6 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464629 22:23104220-23104242 GTGTAAGGTCTAAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 147
1181464622_1181464630 11 Left 1181464622 22:23104191-23104213 CCTGCAGCGGGATGACGGAGGAC 0: 1
1: 0
2: 2
3: 5
4: 70
Right 1181464630 22:23104225-23104247 AGGTCTAAGCAGGCAGGGCAAGG 0: 1
1: 0
2: 6
3: 34
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181464622 Original CRISPR GTCCTCCGTCATCCCGCTGC AGG (reversed) Intronic
900577880 1:3393312-3393334 GTCCTCCCTGAGGCCGCTGCTGG + Intronic
900650994 1:3730075-3730097 GCCCTCCGTCAACCAGCTGGTGG + Exonic
900739750 1:4323447-4323469 GTCCTCTGTCCTCCTGCTGAGGG + Intergenic
902714413 1:18262611-18262633 GACCTCTCTCATCCCGCTTCTGG - Intronic
906191771 1:43903569-43903591 GTCCTCTCTCTTCCCCCTGCAGG - Intronic
906671543 1:47658644-47658666 CTCCTCCGTCATTCCCATGCCGG + Intergenic
907213424 1:52842632-52842654 GCCCTCCGACACGCCGCTGCCGG - Intronic
911084312 1:93963755-93963777 GTACTCAGTCCTCCCACTGCTGG + Intergenic
923759130 1:236824198-236824220 GTCCTCTGTTATCCCAATGCAGG + Exonic
1063056236 10:2507448-2507470 CTCCTCCATCATCCCTCTGAAGG + Intergenic
1067464582 10:46488064-46488086 GTCCTCCTTCACCCAGCAGCAGG - Intergenic
1067622613 10:47896589-47896611 GTCCTCCTTCACCCAGCAGCAGG + Intergenic
1075694619 10:124424557-124424579 GTCCTCCTCCATCCCTCTTCTGG - Intergenic
1080321113 11:31010355-31010377 GTCCTCAGTCATGCAGCTGCAGG - Intronic
1084118774 11:67056892-67056914 GGCCGCCGTCATCCCGGGGCCGG - Exonic
1088314934 11:108498126-108498148 GGCCTCCCTCGTCCCGCGGCCGG - Intronic
1090865669 11:130698485-130698507 CTCCTCAGGCCTCCCGCTGCTGG - Intronic
1092146066 12:6215490-6215512 TTCCTGGGTCATCCTGCTGCTGG + Intronic
1092524426 12:9301141-9301163 GGCCGCCGGCATCCGGCTGCAGG + Intergenic
1102035446 12:109768463-109768485 CGCCTCCGTCATCCCCCTGCCGG + Exonic
1104612565 12:130241384-130241406 GTCCTCAGTCTTCTCCCTGCTGG - Intergenic
1112980649 13:105380720-105380742 GTCCTCCTTTATCACCCTGCTGG - Intergenic
1118257570 14:64218463-64218485 GTCCCCCGTCTTCCTGCTGTGGG - Exonic
1119396244 14:74328185-74328207 GTCTTCCGTCCTCACCCTGCAGG - Intronic
1136066043 16:27759592-27759614 GTCCTAGGTCATTCAGCTGCTGG - Intronic
1136630352 16:31486226-31486248 TGCCTCCGTCATCGCGCTTCTGG + Exonic
1137966189 16:52936006-52936028 GACCTCCGTCCTGCCGCTGATGG + Intergenic
1139224494 16:65221106-65221128 GACCTCTGTCATCTGGCTGCAGG + Intergenic
1145093983 17:20009226-20009248 GTCCTCCTTCAGCCGGCGGCCGG - Intergenic
1147689493 17:42306645-42306667 GCCCTCCGTCATCTCGCTCTTGG - Intronic
1148766761 17:50044043-50044065 GGCCTCCGTCATCTCTCCGCTGG + Intergenic
1151916064 17:77118901-77118923 GGCTTCCTTCATCCCGCTGAAGG - Intronic
1152314980 17:79574954-79574976 CTCCTGCGTGATGCCGCTGCTGG + Intergenic
1152386773 17:79979458-79979480 GTCCTCCCGCCTCCCGCTTCAGG - Intronic
1152633321 17:81420407-81420429 TTCCCCAGTCTTCCCGCTGCTGG + Intronic
1157322031 18:46642120-46642142 TTCCTCCATCATCCCACTCCTGG + Intronic
1160983392 19:1826899-1826921 GTCCTCCGTCTTGACGCTGGTGG + Exonic
1161162964 19:2770799-2770821 GTCCTGCCTCTTCCAGCTGCTGG - Intronic
1163607058 19:18281341-18281363 GTCCTTCTTCATCATGCTGCCGG + Exonic
1165363502 19:35350778-35350800 ATCCTCCATCAGCCCGCTGAGGG + Intergenic
1165365644 19:35363235-35363257 ATCCTCCATCAGCCCGCTGAGGG + Intergenic
1168333156 19:55580985-55581007 GTCCCCCGTCCTCCCGCTTCCGG - Intergenic
932337433 2:70939038-70939060 CTCCTCCCTGATCCCGCTGGAGG - Intronic
932346765 2:71000932-71000954 GTCCTGCCTCATCTCCCTGCAGG + Intergenic
933876827 2:86628311-86628333 GTCCTCAGTCCTCCCACTCCAGG + Intronic
1176299613 21:5092713-5092735 GTCCTCCGTCATCCTGCTGTAGG - Intergenic
1176429836 21:6568738-6568760 GCTCTCCCTCATCCCACTGCTGG + Intergenic
1179705230 21:43176200-43176222 GCTCTCCCTCATCCCACTGCTGG + Intergenic
1179857413 21:44169234-44169256 GTCCTCCGTCATCCTGCTGTAGG + Intergenic
1180037726 21:45258282-45258304 GTCCTGGGTCATCCACCTGCTGG + Intergenic
1181464622 22:23104191-23104213 GTCCTCCGTCATCCCGCTGCAGG - Intronic
1182143468 22:27982394-27982416 GAGCTCCGTCATGCTGCTGCAGG + Exonic
952273053 3:31851445-31851467 CTCCTCCCTCATCCCGCTGTGGG - Intronic
971243178 4:24906849-24906871 GTCCTCCCTCATCCCCCCTCAGG - Intronic
972567960 4:40285815-40285837 GTCCTCCGTCAGCACCCTGAAGG - Intergenic
977722363 4:100254454-100254476 GTCCTCCTTCCTCCTTCTGCAGG - Intergenic
986290667 5:6396727-6396749 GCCCTCCCTGCTCCCGCTGCTGG - Intergenic
998331672 5:141332799-141332821 GGCCTTCGTCATCGTGCTGCTGG + Exonic
998333056 5:141346148-141346170 GGCCTTCGTCATCGTGCTGCTGG + Exonic
998335358 5:141366445-141366467 GGCCTTCGTCATCGTGCTGCTGG + Exonic
998336467 5:141376198-141376220 GGCCTTCGTCATCGTGCTGCTGG + Exonic
998340751 5:141415302-141415324 GGCCTTCGTCATCGTGCTGCTGG + Exonic
998342836 5:141432874-141432896 GGCCTTCGTCATCTTGCTGCTGG + Exonic
999424594 5:151476309-151476331 GTGCTCTGTCCTCCTGCTGCAGG - Intronic
1001928884 5:175658704-175658726 GTCATCGGTCATCCGGCAGCGGG - Intronic
1018075926 6:160213746-160213768 GTCCTCCTTTGTTCCGCTGCTGG + Intronic
1018980548 6:168598696-168598718 GTCCTCCTTCACCCCGGAGCAGG - Intronic
1019625237 7:2012582-2012604 ATCCTCCTTCCTCCCGCTCCTGG - Intronic
1021664921 7:22967662-22967684 GTCCTCCTTCATCTCACTACTGG - Intronic
1032084430 7:128876671-128876693 GTCCTCCTTCTACCCACTGCAGG + Intronic
1034970027 7:155413091-155413113 GTCCTTCCTCACCCTGCTGCTGG - Intergenic
1035404633 7:158589004-158589026 GACCTCCGTCATCTCCTTGCTGG + Intergenic
1039243757 8:35585202-35585224 GTGCTCTGTAATCCCTCTGCTGG - Intronic
1043747637 8:83896070-83896092 GTCCTACTTCATCAAGCTGCTGG - Intergenic
1053291383 9:36881809-36881831 GTCCTCCCTGGTGCCGCTGCTGG + Intronic
1057261542 9:93587428-93587450 ATCCTCCGTCATCCCTCTCCTGG - Intronic
1057274440 9:93668830-93668852 GGCCCCCCTCAGCCCGCTGCAGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic