ID: 1181465701

View in Genome Browser
Species Human (GRCh38)
Location 22:23109527-23109549
Sequence ACCCAGGGCCTACACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181465692_1181465701 1 Left 1181465692 22:23109503-23109525 CCAAGGGGACCCCAGAGCATGGG 0: 1
1: 0
2: 3
3: 31
4: 300
Right 1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG 0: 1
1: 1
2: 2
3: 12
4: 139
1181465698_1181465701 -10 Left 1181465698 22:23109514-23109536 CCAGAGCATGGGTACCCAGGGCC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG 0: 1
1: 1
2: 2
3: 12
4: 139
1181465695_1181465701 -8 Left 1181465695 22:23109512-23109534 CCCCAGAGCATGGGTACCCAGGG 0: 1
1: 1
2: 1
3: 27
4: 198
Right 1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG 0: 1
1: 1
2: 2
3: 12
4: 139
1181465697_1181465701 -9 Left 1181465697 22:23109513-23109535 CCCAGAGCATGGGTACCCAGGGC 0: 1
1: 0
2: 3
3: 17
4: 228
Right 1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG 0: 1
1: 1
2: 2
3: 12
4: 139
1181465687_1181465701 20 Left 1181465687 22:23109484-23109506 CCAAGTGAGGGTCTCAAGACCAA No data
Right 1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG 0: 1
1: 1
2: 2
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181465701 Original CRISPR ACCCAGGGCCTACACTTGGG AGG Intronic
900211045 1:1456027-1456049 ACCCTGAGCCTACACGAGGGTGG - Intronic
900223952 1:1524075-1524097 ACCCTGAGCCTACACGAGGGTGG - Intronic
901687468 1:10951035-10951057 ACCCAGGGCCTGGGCATGGGAGG - Intronic
904340178 1:29829260-29829282 ACCCAGGGCCTCCTGCTGGGCGG + Intergenic
904927591 1:34060925-34060947 ACCCAGGGGATACAGGTGGGTGG - Intronic
906817038 1:48889841-48889863 ACCCAGGGTCTTGAATTGGGAGG + Intronic
906943125 1:50273178-50273200 TCTCAGGGCCTCCACTAGGGAGG - Intergenic
910096362 1:83526522-83526544 ATCCATGGACTACACTTGGTAGG - Intergenic
915691514 1:157695551-157695573 TCCCAGGGCCCACACTGTGGTGG - Exonic
921902240 1:220463234-220463256 CCCCAGGTCCTGTACTTGGGAGG - Intergenic
921964251 1:221071105-221071127 AACCAGGGCCCACACAAGGGAGG - Intergenic
922861219 1:228818391-228818413 ACCCGGGTCCTGCACCTGGGAGG - Intergenic
924805956 1:247361868-247361890 ACCCAGGCCCTAGATTAGGGTGG + Intergenic
1066321892 10:34311118-34311140 ACTGAGGGCTTTCACTTGGGCGG + Intronic
1073007529 10:100336249-100336271 CCCCAGTGTCTACACTTGGACGG - Intergenic
1075274455 10:121080666-121080688 ACCCTGGGACTACAGATGGGAGG + Intergenic
1076798943 10:132811835-132811857 ACCCAGGGCCTGCACTTGGGTGG - Intronic
1077154852 11:1086682-1086704 ACCCAGGACCTGCTCATGGGTGG - Intergenic
1078508764 11:11969944-11969966 ACTCAGTCCCTTCACTTGGGCGG - Intronic
1079446230 11:20558604-20558626 ACCCAGGACATAGAGTTGGGAGG - Intergenic
1084093078 11:66892056-66892078 ACCCATGGCAGACGCTTGGGAGG + Intronic
1084575818 11:69987214-69987236 CACCAGGGCCTACTCTTGTGCGG + Intergenic
1085256543 11:75176826-75176848 GCCCAGGGCCTCCACTTTGCAGG + Intronic
1087892106 11:103547288-103547310 ACCCAGGGCCTACCCTTTTTTGG - Intergenic
1089617481 11:119703103-119703125 TCCCAGGGCCTGCACATGGGAGG + Intronic
1094399876 12:30050952-30050974 ACCCAGGGCCTTTACTAGGAGGG - Intergenic
1096978869 12:55717047-55717069 GGCCAGTGCCTAAACTTGGGCGG - Intronic
1102060332 12:109926555-109926577 ACCCAGGTCCTGCACCTGGGAGG - Intronic
1102328637 12:112011153-112011175 GCCCAGGTCCTGCACCTGGGAGG + Intronic
1103333613 12:120172478-120172500 TTCCAGGGCCTCCTCTTGGGAGG - Intronic
1104429139 12:128702709-128702731 ACCAAAAGCCCACACTTGGGTGG - Intronic
1106373249 13:29158244-29158266 ACTCAGTGCCTGCACTTGGTAGG - Intronic
1111843198 13:93474523-93474545 ACCCAGGGCCAAGTTTTGGGAGG + Intronic
1112325149 13:98438949-98438971 CCCCAGGTCCCTCACTTGGGTGG - Intronic
1115641869 14:35340308-35340330 ACCCAGGGCCTGTACCCGGGTGG - Intergenic
1117454002 14:55879584-55879606 GCACAGTGCCTACACTTGGTGGG + Intergenic
1118192646 14:63594478-63594500 ACCCAGGGCCTTCCCCAGGGTGG + Intergenic
1122491147 14:102116898-102116920 GCCCAGATCCTACACCTGGGAGG - Intronic
1122649750 14:103220129-103220151 CCCCAGGGCAGACACTTGCGAGG + Intergenic
1128211718 15:65908122-65908144 ACCCTGGGCCTATACTCAGGAGG - Intronic
1129678571 15:77645314-77645336 CCCCAGGGCCCACAGTGGGGTGG + Intronic
1129758118 15:78110934-78110956 GCCCATGGCCTGCAGTTGGGTGG + Intronic
1130068457 15:80626643-80626665 ACCCAGGGCCTGCACAGGGCAGG - Intergenic
1130654067 15:85779724-85779746 CCCCAGTGCCTGCACTTGGCAGG - Intronic
1132873309 16:2124967-2124989 ACCCTGGGCCTGCTCTCGGGAGG - Intronic
1133478317 16:6145193-6145215 ACCCAGGGCCTTTCCTAGGGTGG - Intronic
1133562295 16:6961313-6961335 ACCCAGGGGCTCCACTTGCATGG - Intronic
1134552397 16:15144146-15144168 ACCCTGGGCCTGCTCTCGGGAGG - Intergenic
1136012702 16:27374393-27374415 ACCCAGGGGTTACAATAGGGAGG - Intergenic
1137698527 16:50478828-50478850 ACCCAGGTCCTGCACCTGGGAGG + Intergenic
1140728842 16:77838183-77838205 ACACAGGGACTACTCTTGGCCGG + Intronic
1147980285 17:44269852-44269874 ACCCTGGGCCCACACTGGGTTGG + Intergenic
1149459748 17:56818893-56818915 AACAATGGCCTAGACTTGGGTGG - Intronic
1149658077 17:58320573-58320595 AGCCTGGGCCTACAGGTGGGGGG + Exonic
1152614551 17:81331734-81331756 GCCCAGGGCCTGCAGCTGGGAGG - Intergenic
1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG + Intronic
1161398885 19:4059009-4059031 TCCCAGGGCCGAGCCTTGGGTGG - Intronic
1161708624 19:5834464-5834486 ACCCAGTGCCCACACTCCGGGGG - Intronic
1161714651 19:5868353-5868375 ACCCAGTGCCTACACTCTGAGGG - Intronic
1162450074 19:10749186-10749208 ACCCAGAGCCTTCCCATGGGAGG - Intronic
1163437295 19:17303182-17303204 CCCCGGGGCCTCCACTTCGGAGG - Intronic
1163690696 19:18736761-18736783 ACCCAGGGCCTCCCTGTGGGGGG - Intronic
1165022512 19:32936042-32936064 ACCCAGGTCCTACACATGGGAGG - Intronic
1165809956 19:38606159-38606181 GCCCAGGGCCTTACCTTGGGGGG + Exonic
1167970075 19:53183778-53183800 CCTCAGGGCCTTCACATGGGTGG - Intronic
1168662152 19:58175714-58175736 ACCAAGGCCATACACTGGGGAGG + Intergenic
927485076 2:23483174-23483196 ACCCAGAGCACACACTTGAGGGG + Intronic
929924389 2:46196646-46196668 GCCTAGGGCCTTCACTTTGGCGG + Intergenic
930968280 2:57359494-57359516 CACCAGAGCCTACACTGGGGTGG - Intergenic
932522330 2:72427331-72427353 ACCCAAGTCCTGCGCTTGGGAGG - Intronic
935646837 2:105344230-105344252 TCCCAGGGCACACACTTTGGAGG + Intronic
936427811 2:112435051-112435073 GCCCAGGGACCACACTTGGCAGG - Intergenic
937985773 2:127637492-127637514 ACCCAGGGCCTGTCCTTGGCGGG + Exonic
939477606 2:142706715-142706737 TCCTAGGGCCTACACTTTGGTGG - Intergenic
941850690 2:170177158-170177180 ACCCAGGACCAAGACTTGAGTGG - Intergenic
945911712 2:215657366-215657388 ATCCAGGCCCTACCCTTAGGGGG - Intergenic
948420804 2:237859197-237859219 CCCCAGCGCCTGCACCTGGGCGG + Intronic
1170500899 20:16974664-16974686 ATCCAGGTCCTGCACCTGGGAGG - Intergenic
1170779495 20:19411485-19411507 ATCCAGGTCCTAGACTTGGGAGG - Intronic
1170964606 20:21055176-21055198 AGCCAGGGTCTCCACATGGGGGG + Intergenic
1173524539 20:43721699-43721721 ACCCAGGTCCTGCACTTGGGAGG + Intergenic
1174717037 20:52770662-52770684 CCCCAGTGCCTCCACTTGGCTGG + Intergenic
1176374433 21:6080160-6080182 GCCCAGGGACCACACTTGGCAGG + Intergenic
1178467178 21:32859132-32859154 ACCCAGGTCCTGCACCTGGGAGG + Intergenic
1179749042 21:43458085-43458107 GCCCAGGGACCACACTTGGCAGG - Intergenic
1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG + Intronic
1183439517 22:37815468-37815490 ACCCAGGGCCTTCCCCAGGGTGG - Exonic
1184034329 22:41911275-41911297 ACCCTGGGCCCACCCCTGGGTGG - Exonic
1184613508 22:45622067-45622089 ATCCAGGTCCTGCACCTGGGAGG - Intergenic
1184727804 22:46356641-46356663 ACCCAGTGGCTTCACTAGGGAGG - Intronic
1185162946 22:49240458-49240480 CCCCAGGGCCTGCACTCGGAAGG + Intergenic
952817694 3:37459889-37459911 ACCCACTGGCTACTCTTGGGGGG + Intronic
952977237 3:38706934-38706956 ACCCAGGGATTAAACTTGTGTGG - Intronic
953387804 3:42516499-42516521 AACCAGGCCCTGCCCTTGGGAGG - Intronic
953473113 3:43183346-43183368 AACCAGGGCCTAGACATGAGTGG - Intergenic
954325025 3:49858916-49858938 TCCCAGGCCCTAAACTTGGGCGG - Exonic
955083663 3:55680994-55681016 CCACAGGCCCTACACTTGGAAGG - Intronic
960690505 3:120341968-120341990 ACCCAGCTCCTGCACCTGGGAGG - Intronic
961458958 3:127038275-127038297 CCCAAGGGCCTACGTTTGGGCGG - Intergenic
964791895 3:160460516-160460538 ACCCAGGTCCTTCGCCTGGGAGG + Intronic
968442000 4:628911-628933 TCCCAGGGCCTGCACAAGGGGGG + Intronic
968750198 4:2384898-2384920 GCTCAGGTCCTAGACTTGGGGGG + Intronic
970408396 4:15785118-15785140 ACCCAGGCCCCACACCTGGAAGG - Intronic
971175365 4:24277403-24277425 AGACAGAGCCTACACTTGGAGGG - Intergenic
972203834 4:36747696-36747718 GCCCAGGTCCTGCACCTGGGAGG - Intergenic
972795079 4:42407694-42407716 TCCCAGGGACGACAATTGGGTGG - Intergenic
973290306 4:48464325-48464347 ACCCAGGGCATACACAGGTGGGG - Intergenic
975913555 4:79297438-79297460 GCCCAGGCCCTACGTTTGGGAGG - Intronic
976276801 4:83286564-83286586 ACCCAGGGCCTACGCTAAGAAGG - Intergenic
980882300 4:138724242-138724264 ACCCAGTGTCTAGACTTGGCTGG + Intergenic
981232132 4:142369114-142369136 ATCCAGGGGTTACACTTGTGTGG + Intronic
983119039 4:163857837-163857859 ACCCAGAGCTTACAATTAGGAGG + Intronic
986833675 5:11610236-11610258 ACCCAGTGCCTTCTCTTGGCCGG + Intronic
989396475 5:40962542-40962564 TCCCAGGGCCTACAGTTATGAGG - Intronic
990023627 5:51159564-51159586 ACTCAGGTCCTGCACCTGGGAGG - Intergenic
993187168 5:84635623-84635645 ACCCAGGTCCTGCACCTGGGAGG + Intergenic
996599161 5:125241535-125241557 ACCCAGGGCCTACTTGAGGGTGG - Intergenic
1001434499 5:171688734-171688756 TCCCAGGGCCTTCACGGGGGTGG - Intergenic
1002644449 5:180646290-180646312 ACCCAGGGGATAAACTGGGGTGG - Intronic
1005393050 6:25353067-25353089 AGCCAGGACCTACAGTTGGTGGG - Intronic
1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG + Intronic
1008571084 6:52817278-52817300 TCTCAGGGCCTTCACCTGGGTGG - Intergenic
1008578742 6:52886113-52886135 TCCCAGGGCCTTCACCTAGGTGG - Intronic
1011934809 6:92762930-92762952 ACCCAGGGTTCACACTGGGGAGG - Intergenic
1013799091 6:113919755-113919777 ACCCAGGGCCTACATTATAGAGG + Intergenic
1015455734 6:133424577-133424599 ACCCAGATCCTGCACCTGGGAGG + Intronic
1023088247 7:36593834-36593856 TCCCAGGGCCCACACTTGGCAGG - Intronic
1026976654 7:74502822-74502844 ACCCAGGCCCTGCACCTGGCTGG + Intronic
1029530562 7:101122454-101122476 ACCCAGGGCCCACCAGTGGGTGG + Intergenic
1034342356 7:150366085-150366107 GGCCAGGGCATCCACTTGGGAGG + Intergenic
1037825698 8:22159477-22159499 ACCCAAGACCTTCACTTGGTTGG + Intronic
1038612306 8:29068331-29068353 ACCCCGGGCCAGCACTTGGCAGG - Exonic
1045252070 8:100490672-100490694 ACCCATGGCCAGAACTTGGGCGG - Intergenic
1047104774 8:121720318-121720340 ACCCAAGCCCTATACCTGGGAGG + Intergenic
1049021709 8:139961592-139961614 GCCCAGGTCCTGCACCTGGGAGG - Intronic
1052385805 9:27822546-27822568 ACGCATGGCCTACAATTGGCTGG - Intergenic
1056311028 9:85341141-85341163 CCCCAGGGCTCACACTGGGGAGG - Intergenic
1057144342 9:92748249-92748271 TCCCAGGTTCTCCACTTGGGGGG + Intronic
1057694050 9:97311112-97311134 ACCCAGGGCAGACTCCTGGGTGG + Intronic
1060465228 9:123898074-123898096 GCACAGGGCTTACACTTAGGTGG - Intronic
1060525739 9:124320318-124320340 CCCCAGGGCCCACACATGGGGGG + Intronic
1061068700 9:128295417-128295439 ACCCAGGGAGGACACTTGGAAGG + Intergenic
1062164873 9:135102603-135102625 ACCCAGGGCCTGGGCTGGGGCGG - Intronic
1062591681 9:137277386-137277408 ACACAGGGCTTACAGCTGGGGGG - Intergenic
1062631286 9:137464263-137464285 ACCCAGGGCCAAGAGGTGGGGGG + Intronic
1186350666 X:8735851-8735873 AACCAGGGACTACACTTTGAGGG + Intergenic
1186576211 X:10768743-10768765 ATCCAGGGCATAAACTTTGGAGG + Intronic
1186959266 X:14717205-14717227 ACCCAGGCCCTCCACTTGGAGGG - Intronic
1187073029 X:15907514-15907536 TCCCAGTGTCTTCACTTGGGTGG + Intergenic
1188317086 X:28688282-28688304 CCCAAGGTCCTCCACTTGGGAGG + Intronic
1189013555 X:37071618-37071640 AGCCAGTGCCTACACATGGTGGG - Intergenic
1189656843 X:43253438-43253460 CCCCAGGGCTGACACTTGAGAGG - Intergenic
1196815605 X:119663319-119663341 AGACAGGGCCTATGCTTGGGAGG + Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1200144374 X:153918955-153918977 GCCCAGGCCCTGCACTTGGGAGG + Exonic