ID: 1181471080

View in Genome Browser
Species Human (GRCh38)
Location 22:23140319-23140341
Sequence CTCCTCCTTCAGCTTGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181471072_1181471080 20 Left 1181471072 22:23140276-23140298 CCATGAGGGCTTTCTGCCTCGTC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG 0: 1
1: 1
2: 2
3: 55
4: 366
1181471076_1181471080 -10 Left 1181471076 22:23140306-23140328 CCTCTGACTGCAGCTCCTCCTTC 0: 1
1: 0
2: 4
3: 62
4: 611
Right 1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG 0: 1
1: 1
2: 2
3: 55
4: 366
1181471075_1181471080 4 Left 1181471075 22:23140292-23140314 CCTCGTCTGGAGGTCCTCTGACT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG 0: 1
1: 1
2: 2
3: 55
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181471080 Original CRISPR CTCCTCCTTCAGCTTGGGCA GGG Exonic
900096966 1:943729-943751 CTCCTCCGTCAGCAGTGGCAGGG - Exonic
900437256 1:2636947-2636969 CTCCTCATTCTTCTTGGACACGG - Intronic
900555678 1:3279243-3279265 CTCCTGCTCCAGCTTCTGCAGGG - Intronic
901325326 1:8361862-8361884 TTCCTCCTTCACCTTCTGCAGGG + Exonic
902034107 1:13444011-13444033 CTCTTTCTTCAGCTTGGAGAGGG + Intergenic
902467373 1:16626446-16626468 CTCTGCCCTCAGCTTGGTCACGG + Intergenic
902507208 1:16946290-16946312 CTCTGCCCTCAGCTTGGTCATGG - Exonic
902885689 1:19403162-19403184 CTGGTGCTTCAGCTTAGGCAGGG + Intronic
903058681 1:20654469-20654491 CTCCCCCTTCAGGTAGGGCCAGG - Intronic
903323558 1:22556511-22556533 CTCCTCCTTCAGCTTGGCTCAGG - Intergenic
903341988 1:22660512-22660534 GTCCTTCTTCAGCTAGAGCAGGG - Intronic
903388319 1:22944627-22944649 AGCCCCCTTCTGCTTGGGCAGGG - Intergenic
903575058 1:24334561-24334583 CCCCTCCTGCAGCTTTGGCCAGG - Intronic
904273089 1:29363156-29363178 CTCCTTCTCCACCTTGGGAAGGG - Intergenic
904334162 1:29786272-29786294 CTCCTGCTTCAGCCTGGCCTTGG + Intergenic
904433196 1:30478430-30478452 CTCCTTCTCCAACCTGGGCAGGG - Intergenic
905441368 1:37998215-37998237 CTCCTCTCTCAGCGTGAGCAGGG + Intronic
905441863 1:38000955-38000977 CTTCTCCTTCAGCTTGAGCCAGG - Intronic
905923919 1:41736597-41736619 CTCATCCTGCATCTGGGGCATGG - Intronic
906163617 1:43669488-43669510 CTCCTCCCTCTGCCTGGTCAGGG + Intronic
906412548 1:45590437-45590459 CTCCTGCCTCAGCCTGGGCCTGG - Intronic
906858553 1:49333797-49333819 CTCCTTGTTCAGTTTGGCCATGG + Intronic
907341744 1:53740020-53740042 CTCTTCCTACACGTTGGGCAGGG - Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
911115801 1:94246383-94246405 CTCCTCATTCAGTTTGGGAGAGG - Intronic
911733379 1:101312235-101312257 TTCCTCCAGCAGCCTGGGCAAGG + Intergenic
913299791 1:117358544-117358566 CTCCTGCTTCGGCTGGCGCACGG + Intergenic
914250972 1:145920996-145921018 CACCTCCTTCAGATTGGGGCAGG + Intergenic
914858516 1:151369151-151369173 CTCGTCCTTCAGGTTGGGCATGG + Exonic
915718867 1:157968908-157968930 CTCCTTCATCAGCTTGCACAGGG + Intergenic
915936216 1:160091710-160091732 CTCCTCCTCCAGGTGGGGCCTGG + Intronic
916475314 1:165163135-165163157 GTCCTGTTTCAGCTTGGGCCCGG - Intergenic
916630569 1:166607898-166607920 CTTCTTCTTCAGGTTGGGCAGGG + Intergenic
918279234 1:182987035-182987057 CTCCTCCTCCTTCTTGGGCCTGG + Intergenic
919650921 1:200148126-200148148 CACCTCCTCCAGCGTGGGCAAGG - Intronic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
919885829 1:201934030-201934052 TCCCTCCTTCTCCTTGGGCATGG + Intronic
919913068 1:202123722-202123744 CTCCTCCTTTACCTTGGAGAAGG + Intronic
919924099 1:202183376-202183398 CACCTCCTTCAGCTCCTGCAGGG - Intergenic
919958117 1:202438987-202439009 CTCCTGCTTCCGGTTGGCCAGGG - Intronic
919982007 1:202647571-202647593 CTCCTCATTCAGCTAGGGCCTGG - Intronic
920030492 1:203034706-203034728 CTCCTCCTCCAGCCTGGGGAAGG - Intronic
920038047 1:203078106-203078128 CTCTCCCTTAGGCTTGGGCAAGG + Exonic
920250387 1:204618901-204618923 TACCTCCTGCAGGTTGGGCAGGG + Exonic
920533812 1:206724171-206724193 CTGCTCCTTGGGCATGGGCATGG - Intronic
921486601 1:215722596-215722618 CTCCTCCTTGACATTGGGAAAGG + Intronic
922251114 1:223849373-223849395 CTCCTCCCTTCCCTTGGGCAGGG - Intergenic
923388202 1:233486796-233486818 CTCCTTGTTCAGCTTGTTCAGGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063448447 10:6134913-6134935 CTCCTCCTTCCGCAGGGGCAAGG - Intergenic
1063630560 10:7730010-7730032 CTCCTTGTTCAGTTTGGGCATGG + Exonic
1066430876 10:35350044-35350066 CTCCTCCTCCAGCTTTGCAAAGG + Intronic
1067781357 10:49209598-49209620 TTCATTCTTCAGCCTGGGCAAGG + Intergenic
1068798095 10:61106587-61106609 CTCTTCCTTTAGCTTGGGTCTGG - Intergenic
1069383853 10:67866494-67866516 CCTCTCCTTGAGCGTGGGCAGGG - Intergenic
1069984766 10:72275537-72275559 CTCTTCCTTCACCCTGGGCCGGG - Exonic
1070273004 10:74976140-74976162 CTCCTCCTCTAGCTGGGGGATGG + Exonic
1071577991 10:86743895-86743917 GTTCTGCTTCAGCTTGGGCTGGG - Intergenic
1071727315 10:88212311-88212333 TTCCTACTTCATCTTGTGCAAGG + Intergenic
1072855024 10:98937256-98937278 GCCCTGCTTCAGCTTGCGCACGG - Intronic
1075090224 10:119440167-119440189 CTCTTCCTTCTGGGTGGGCAGGG - Intronic
1075473814 10:122715716-122715738 CTCCTCCTAGAGGTTGGGGAGGG + Intergenic
1075973719 10:126676631-126676653 GCCCTGCTTCAGCTCGGGCATGG - Intergenic
1077561368 11:3263729-3263751 CCTCTCCATCAGCTTGGGCTTGG - Intergenic
1077567264 11:3309558-3309580 CCTCTCCATCAGCTTGGGCTTGG - Intergenic
1077585644 11:3450058-3450080 CTTCTTCTTCAGGTTGGGCAGGG + Intergenic
1078141919 11:8699225-8699247 CAGCTCCTTCAGTTTGGGGAGGG + Exonic
1078793694 11:14570411-14570433 ATCCTCCTTTAGCTTGGAGAAGG - Intronic
1079299217 11:19262539-19262561 CTCTTTCTCCAGCATGGGCATGG - Intergenic
1079393498 11:20042417-20042439 CTCATCATTCAGCTGTGGCAAGG - Intronic
1081618651 11:44605408-44605430 CTTCTACTTCAACATGGGCAAGG + Exonic
1081695216 11:45104902-45104924 CTCCTCCTGCATCCTGGACAGGG + Intronic
1082951166 11:58817142-58817164 TTCCTCCTTTAGCTTGGAGAAGG - Intergenic
1083856493 11:65395656-65395678 CTCCTCCTTCATGTGGGGCGGGG + Intronic
1083993728 11:66261890-66261912 CTCCTCCTCGAGCTGGGCCACGG - Exonic
1083996134 11:66273586-66273608 CTCCTCCTTACTCTTGTGCATGG + Intronic
1084949772 11:72658229-72658251 CTCCCCCATCAGATTGGGCTGGG + Intronic
1085331992 11:75660122-75660144 CTCCTCCTTCAACTTTTTCATGG + Intronic
1085797160 11:79552812-79552834 ACCCTGCTTCAGCTTGTGCATGG - Intergenic
1086727889 11:90211665-90211687 CTCAGCATTGAGCTTGGGCATGG - Intronic
1088167709 11:106957511-106957533 CGCCTCCTTTGGCTTGGGGAAGG + Intronic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1089683578 11:120133010-120133032 CTCCTCCTTCACCTTGCAGATGG + Intronic
1090373787 11:126275103-126275125 TTCCTCCTTCAGCTTGGCTGTGG - Intronic
1090643999 11:128752862-128752884 TTTCTCCTCCAGTTTGGGCAAGG - Intronic
1090804843 11:130196475-130196497 CTCCCCCTGCAGCATGGGCCCGG - Intronic
1091743231 12:2974702-2974724 CTCCTCCTTCTCCCAGGGCAGGG + Intronic
1091873123 12:3911751-3911773 CTCCTCCTTCACCTTCTGCCAGG + Intergenic
1092204055 12:6604966-6604988 CTCCGCCCTCACCTTGGGCAAGG + Intronic
1092963806 12:13622311-13622333 CTCTTCCTTTAGCTTGCTCAGGG - Intronic
1093710235 12:22321423-22321445 CTGCTGCTTCAGTTTGGGCAGGG - Intronic
1093824710 12:23669888-23669910 CTCCTCCCTCAGCTTCGGACTGG - Intronic
1096145457 12:49275854-49275876 TTCTTCCTGCAGCCTGGGCAGGG + Intergenic
1096559105 12:52423376-52423398 CTGCTCCTTCACCCTGGACAAGG + Intergenic
1096964738 12:55617056-55617078 ATCCTCATTCTTCTTGGGCATGG + Intergenic
1101381064 12:104214602-104214624 CTTGGCCTTCAGCTTGGGCCAGG - Intergenic
1102025480 12:109712202-109712224 CCCCACCTTCAGCCTGGGGAGGG + Intergenic
1102681213 12:114692046-114692068 TTCCTCCTTTCGCTTGGGAAAGG + Intergenic
1103949455 12:124543085-124543107 CTCCTCCACCAGCTAGGGCAAGG + Intronic
1104098242 12:125581055-125581077 TTCCTCCTTCAGCTTTTTCATGG - Intronic
1104590917 12:130084224-130084246 CTTCTCCTGCCGCTGGGGCATGG - Intergenic
1105020476 12:132813382-132813404 CTCCTCCTTCTCCAGGGGCAGGG + Exonic
1105024052 12:132837021-132837043 CTCCTCATTCAGCTCCTGCAGGG - Intronic
1105055297 12:133093159-133093181 TTCCTTCTTCAGGTTGGGCAGGG + Intronic
1106410768 13:29510098-29510120 CTTCTCTTTAAGCTTGGCCAAGG + Exonic
1106479157 13:30123870-30123892 CTCCCCCTTCAGCCTGGTCCTGG + Intergenic
1106806587 13:33314212-33314234 CTTATCCCTCAGCTTGGGCTTGG - Intronic
1108782650 13:53855481-53855503 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1111254252 13:85645096-85645118 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1111278723 13:85989646-85989668 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1111688929 13:91536614-91536636 CTCCAGCATCAGCTTGTGCACGG + Intronic
1112840661 13:103573482-103573504 ATCCTCATTCTTCTTGGGCATGG + Intergenic
1114566826 14:23639265-23639287 CTCCCCCTGCAGCTTGGCCATGG - Exonic
1119119810 14:72064214-72064236 CACCTCCTTCAGCCTGGTCTAGG - Intronic
1119641008 14:76314874-76314896 TTCCTTCTTCAGCTTGGAAAGGG + Intronic
1120018391 14:79500350-79500372 CTTCTCCTTCATCTTGAGCGAGG + Intronic
1122377814 14:101277949-101277971 CTCCTCCTTACTGTTGGGCAGGG - Intergenic
1122571527 14:102706074-102706096 TTGCTCCTCCAGCCTGGGCAAGG + Intronic
1123020634 14:105396260-105396282 CTCCTCCTTCACCTGGGACCAGG + Exonic
1125228703 15:37427316-37427338 ACCCTGCTTCAGCTTGCGCACGG - Intergenic
1125288014 15:38115091-38115113 CACCTACTTCAGCTGGGGGATGG + Intergenic
1125290692 15:38142664-38142686 GCCCTCCTTCGGCTTGCGCACGG + Intergenic
1128339428 15:66810021-66810043 CTCCTCCTTCTCCTTGGTTAGGG - Intergenic
1128342977 15:66835436-66835458 CTTCTCCTTCAGTGTGGGCTGGG + Intergenic
1128772522 15:70292711-70292733 GTTCCCCTTCAGCTTGGGCTTGG - Intergenic
1129176670 15:73845214-73845236 CTCCTTCTTCACACTGGGCATGG - Intergenic
1129693699 15:77728535-77728557 CTCCAGCTCCAGCTTGGGGATGG + Intronic
1129934230 15:79436081-79436103 CTCCTCCCTCAGCCTGGGTCTGG + Intronic
1130403569 15:83579192-83579214 CTCTTACTTCTGCTGGGGCAGGG - Intronic
1132409025 15:101562705-101562727 CTCCTCCTCCTGCAGGGGCAGGG + Intergenic
1132470490 16:100127-100149 CACCACCTTAGGCTTGGGCAGGG - Intronic
1132728126 16:1347537-1347559 CTCCTCCTTCAGCCTCTGCAGGG - Exonic
1132782795 16:1637377-1637399 CTCCTCCTCCCGCCTGGGCCCGG + Intronic
1133102212 16:3486389-3486411 CTCCTCCTCAGGCTGGGGCAGGG - Exonic
1135607704 16:23837354-23837376 CACCTCCTTCTGCTTTTGCAGGG + Exonic
1135766017 16:25178537-25178559 TGCCTCCTTCATCTTGGTCATGG + Intergenic
1136684985 16:31988772-31988794 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136785599 16:32932307-32932329 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136884172 16:33921497-33921519 GTCCTGCTGCAGCTGGGGCATGG - Intergenic
1137081891 16:36072082-36072104 ACCCTGCTTCAGCTTGTGCACGG - Intergenic
1137723543 16:50641838-50641860 CTCCTCCTTTAGATGGGGCAAGG + Intergenic
1138454460 16:57113446-57113468 GTTCTCCTGCAGCCTGGGCACGG + Exonic
1140085199 16:71789407-71789429 CTCGTTCTTCAGCTTGGGTTCGG + Exonic
1140950085 16:79808620-79808642 ATCCTCATTCTTCTTGGGCATGG + Intergenic
1141849630 16:86636530-86636552 CTCCTCCTTTAGCTGGGGGTGGG + Intergenic
1141997467 16:87644658-87644680 CTCCACCATCAGCCTGGGCGAGG + Exonic
1142498207 17:317573-317595 CTCCTCCTTCAGCCTTGCCAAGG - Intronic
1144238993 17:13290954-13290976 CTCTTCCTTCAGTTTGGTCTTGG + Intergenic
1145770270 17:27487766-27487788 CTCCCCCTTCACCTTCGGCTAGG - Intronic
1146529097 17:33592688-33592710 CTCCTCCTTCACTTTGGTCCGGG - Intronic
1147266655 17:39238407-39238429 CTCCTGCTTCAAGTAGGGCAAGG - Intergenic
1148164703 17:45475254-45475276 CTCCTCCCTCAGCCTGGACACGG - Exonic
1149303713 17:55328682-55328704 CTCCTCCTTCACCTTCTGCTAGG - Intergenic
1150239901 17:63622812-63622834 CTCCTCCCTCAGCCTGGGGCGGG - Intronic
1150316371 17:64172481-64172503 CTCCAGCTTCTGGTTGGGCATGG + Intronic
1150395921 17:64821921-64821943 CTCCTCCCTCAGCCTGGACACGG - Intergenic
1150485015 17:65537446-65537468 CTCCTCCTTGGTCTTGGGGACGG + Exonic
1151309818 17:73286126-73286148 CTTCTCATTGAGCTGGGGCAGGG + Exonic
1151383542 17:73741604-73741626 CTTCTCCTCCTGCTTGGGCAAGG - Intergenic
1152021946 17:77784409-77784431 CTCCTCCATCTGCTTGGAGATGG - Intergenic
1152223823 17:79083542-79083564 CACGTCCTTCTGCCTGGGCATGG + Exonic
1152532913 17:80930823-80930845 TTCCTCCCACAGCTGGGGCAGGG + Intronic
1152617661 17:81345409-81345431 CTCCACCCTCACCTTGGGCTCGG - Intergenic
1153997022 18:10451842-10451864 CTTCTCCATCAGCATGGCCAGGG + Intergenic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1154454225 18:14506260-14506282 CTACTCCTTCAGTTTGGCCTTGG + Intergenic
1156163368 18:34386946-34386968 ATCCTCATTCTTCTTGGGCATGG + Intergenic
1156206770 18:34894933-34894955 GCCCTGCTTCAGCTTGCGCACGG - Intergenic
1156469816 18:37370235-37370257 CTCCTCCTTCCCCTCGGGCTCGG - Intronic
1157584206 18:48790894-48790916 CTTCTCCTTCTGCTGGGCCATGG + Intronic
1157649390 18:49312642-49312664 ATCCTCATTCTTCTTGGGCATGG + Intronic
1157704783 18:49796053-49796075 CTCCTCCTACATCTTGGTAATGG - Intronic
1157805463 18:50654692-50654714 CTCAGCCTTCAGCCTGGGCAGGG + Intronic
1158440558 18:57471032-57471054 CTTCTCTCTCAGCTTGGGGAGGG - Intronic
1158488477 18:57889213-57889235 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1158845043 18:61432832-61432854 CTCCTCCTACTGCTTTGGCAAGG + Intronic
1159671825 18:71229753-71229775 CTCCTCCTTCAGATTAGGCCAGG + Intergenic
1160046440 18:75391273-75391295 CTCCTCCTTCCTCGGGGGCATGG + Intergenic
1160190940 18:76713501-76713523 ATCTTCCATCAGCCTGGGCATGG + Intergenic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1161045112 19:2130427-2130449 CTTCTCCTTCAGCCGGGGAAAGG + Exonic
1161713534 19:5863341-5863363 CTCCTCCCTCAGCCTGGGCTGGG + Intergenic
1161715975 19:5876610-5876632 CTCCTCCCTCAGCCTGGGCTGGG + Intronic
1161861557 19:6801828-6801850 CTCTTTCTTCATCTTGGGCAGGG + Intronic
1162993737 19:14320239-14320261 CTCTGCCTTCAGGTGGGGCAAGG - Intergenic
1163515526 19:17760950-17760972 CTCCTCATTAAGATGGGGCAGGG - Intronic
1164111140 19:22160468-22160490 ATCCTCCTTTAGCTTGGATAAGG + Intergenic
1164599266 19:29549827-29549849 CTCCTCCTTCAGCTGGGGCATGG + Intronic
1164608826 19:29618579-29618601 CTCCTCCTCCCGCTGGGGCCAGG + Intergenic
1165245064 19:34493939-34493961 GGCCTCTTTCAGCTGGGGCAGGG + Intronic
1165454711 19:35903893-35903915 CTCCGCCCTCACCTTGGGCGGGG - Exonic
1166781726 19:45346692-45346714 CTCCTCCTCCAGCTGGGCCACGG - Exonic
1167033575 19:46979398-46979420 CTCTTCCTCCAGAATGGGCAGGG + Intronic
1167399003 19:49252499-49252521 CTCTTCCCTGAGCCTGGGCATGG - Intergenic
1167619987 19:50555382-50555404 CTCCTCCCTCACCTGGTGCAAGG + Intronic
1202649421 1_KI270706v1_random:166859-166881 CTACTCCTTCAGTTTGGCCTTGG - Intergenic
925243173 2:2352266-2352288 CTCCCCCTTCAGCTTTGTTATGG + Intergenic
926473000 2:13284980-13285002 ATCCTCATTCTTCTTGGGCAGGG - Intergenic
926676460 2:15626803-15626825 CTCCTCCTACAGATTGGGAAGGG + Intronic
926972457 2:18480451-18480473 CTCTTCCACAAGCTTGGGCAAGG - Intergenic
927118591 2:19929465-19929487 CTGGTCTTTCAGCTTGGCCATGG - Intronic
927509046 2:23632916-23632938 CTTCCCCTGCAGCTAGGGCATGG - Intronic
928941377 2:36730690-36730712 ATCCTCATTCTTCTTGGGCATGG - Intronic
931094150 2:58920560-58920582 TTCATTCCTCAGCTTGGGCAAGG - Intergenic
932435211 2:71699330-71699352 CTCCTCCCCCAGCTGGGGCTGGG + Intergenic
932708799 2:74047374-74047396 CTCCACCTTGACCTTGGGCTTGG - Exonic
932825401 2:74934425-74934447 CTCCTCCTTCATCTGGGGTGAGG + Intergenic
933355130 2:81200382-81200404 CTCCTTGTTCAGCTTGGGGACGG + Intergenic
933519023 2:83347633-83347655 GCCCTGCTTCAGCTTGTGCACGG - Intergenic
935226037 2:101054111-101054133 CTACTCCTTCTTCCTGGGCAAGG - Exonic
937295564 2:120807893-120807915 CTTCTCCTTCTGGGTGGGCAGGG + Intronic
941575654 2:167226877-167226899 CTCCTTGTTCAGCTGGGGCATGG + Intronic
941624675 2:167818330-167818352 CTGCCCCTTCAGGTGGGGCATGG + Intergenic
942417495 2:175774155-175774177 CTGCTACTTCAGCTTGGACATGG - Intergenic
942821538 2:180121339-180121361 CCCCTCCTGCAGCCTTGGCATGG + Intergenic
944266127 2:197729121-197729143 GCCCTGCTTCAGCTTGCGCACGG - Intronic
945419391 2:209616102-209616124 ATCCTCATTCTTCTTGGGCATGG + Intronic
945829205 2:214762971-214762993 CTCCTCCTTCACACTGGGGAGGG - Intronic
1172045321 20:32076030-32076052 CACCTCCTTCTGGCTGGGCATGG + Intronic
1172227244 20:33313339-33313361 CCCACCCTTCAGGTTGGGCACGG + Intergenic
1174504673 20:51009574-51009596 CTCCTCCCTCAGGCTGGGCAAGG + Exonic
1175324532 20:58113691-58113713 CACCTACTTCAGCAGGGGCAGGG + Intergenic
1175584122 20:60123974-60123996 CTCCTCCTTAAGATTCCGCATGG + Intergenic
1176602401 21:8805687-8805709 CTACTCCTTCAGTTTGGCCTTGG + Intergenic
1176819944 21:13647037-13647059 CTACTCCTTCAGTTTGGCCTTGG - Intergenic
1177025852 21:15920553-15920575 GCCCTGCTTCAGCTTGCGCATGG + Intergenic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1179614479 21:42572975-42572997 CTCCTCCTGCAGGTTCCGCAGGG - Intronic
1179624767 21:42642676-42642698 CCCCTCATTCAGCTTGGCCTTGG + Intergenic
1180344686 22:11697240-11697262 CTACTCCTTCAGTTTGGCCTTGG + Intergenic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1181535913 22:23544654-23544676 TTCCTTCTTCAGGTTGGGCAGGG - Intergenic
1182423610 22:30260415-30260437 CTCTTCCCCCAGCTGGGGCAGGG + Intergenic
1182461289 22:30485761-30485783 TTCCTGCCTCAGCTTGGGCCTGG + Intergenic
1182697029 22:32204694-32204716 CTCCTCCTCTAACCTGGGCATGG + Intergenic
1183112229 22:35658855-35658877 CTCCTCCTGTTGCTGGGGCAAGG - Exonic
1183300523 22:37056883-37056905 CTCCTCCTGCAGACTGGCCAGGG - Intronic
1183411805 22:37659246-37659268 CGCCTCCCTCAGCTTGGCGAAGG - Exonic
1183948506 22:41339953-41339975 CGCCTCCTTCGGCTTGGTCATGG + Exonic
1184745094 22:46451504-46451526 CCCATCCTTCAGGTTCGGCAGGG - Intronic
1184901322 22:47448283-47448305 CTCCTCCTGCACCTGGGGCTCGG + Intergenic
1184955450 22:47883200-47883222 CTCCCCCTTTAACTTGGGCTAGG - Intergenic
1185017215 22:48351815-48351837 CTCCTCCTTCATCATGGAGACGG + Intergenic
950680805 3:14583854-14583876 CTCCTCCTCCATCTTGGGAGGGG + Intergenic
951508904 3:23480013-23480035 CTCCACCTTCAGGCTGGGGATGG - Intronic
951896526 3:27614774-27614796 ATCCTCATTCTTCTTGGGCATGG - Intergenic
952237870 3:31498932-31498954 CTCATCCCTCAGCGTGGCCAAGG - Intergenic
953360031 3:42287895-42287917 ACCCTGCTTCAGCTTGCGCACGG + Intergenic
953475655 3:43203717-43203739 TTTCTCTTACAGCTTGGGCAGGG - Intergenic
953687198 3:45087282-45087304 CTCCTACAACAGCTTGGGCACGG + Intronic
954576860 3:51681072-51681094 CTCCTCCTTAGGCCAGGGCAGGG + Intronic
954680730 3:52344609-52344631 CTCCTCCTCCTTCTTGGGGAGGG - Exonic
955254136 3:57312355-57312377 CTCTTCCTTCAGCTTTGGGAGGG - Intronic
955534075 3:59904673-59904695 ATCCTCATTCTTCTTGGGCATGG - Intronic
956461920 3:69481181-69481203 GCCCTGCTTCAGCTTGCGCACGG + Intronic
956710732 3:72036608-72036630 CTCCTGCTTCCCCTTGGCCAGGG + Intergenic
957069677 3:75557328-75557350 CTTCTTCTTCAGGTTGGGCAGGG - Intergenic
960333840 3:116392638-116392660 CTCCACCTTCTGGTTGGGGAGGG + Intronic
960568736 3:119164609-119164631 GCCCTGCTTCAGCTTGCGCATGG - Intronic
960639571 3:119812949-119812971 CTCCTACTTCAGGTAGGACATGG + Exonic
960696955 3:120405798-120405820 CTCCTCCTGCAGCTAGTGCCTGG - Intronic
960824941 3:121772656-121772678 GTCGTTCTTGAGCTTGGGCATGG + Exonic
962070944 3:132033705-132033727 CTCCTCCTTCATCTTGGAGTAGG - Intronic
962882006 3:139587167-139587189 AGCCTCCTTCAGCTTTGGCAAGG + Intronic
962932395 3:140050468-140050490 CTTCTCCTTCAGCCTGGGGATGG - Intronic
964555714 3:157936018-157936040 CTCCTCCTTCACCTCTGGCAGGG - Intergenic
965712474 3:171569391-171569413 CTCCTACTTCATCTGGTGCAGGG + Intergenic
965728648 3:171746289-171746311 CTCAGCCTGCAGCCTGGGCACGG + Intronic
965974469 3:174605337-174605359 GTCCTGCTTCGGCTTGCGCACGG - Intronic
966484112 3:180448632-180448654 GCCCTGCTTCAGCTTGCGCACGG - Intergenic
966662102 3:182426250-182426272 GCCCTGCTTCAGCTTGCGCACGG - Intergenic
967166538 3:186784310-186784332 CTGCTGCTTTAGCTTGTGCAGGG + Intronic
967522302 3:190446968-190446990 CTGCTCTTTCAGCTTTTGCATGG - Intronic
967945206 3:194798653-194798675 TTCCTCCTTCAGCTGTGACAAGG + Intergenic
968038161 3:195566078-195566100 CGCCCCTTTCAGCTTGGGGACGG + Intergenic
968295980 3:197576948-197576970 CTACTCCTCCAGCGTGGGGAGGG + Intergenic
968295997 3:197577017-197577039 CTACTCCTCCAGCTTGGGGAGGG + Intergenic
968296013 3:197577085-197577107 CTACTCCTTCAGGTTGGGGCGGG + Intergenic
969000831 4:3979987-3980009 CTTCTTCTTCAGGTTGGGCAGGG + Intergenic
969119762 4:4899535-4899557 CTTCTCCTCCTGCTTGGACAAGG - Intergenic
969691663 4:8707282-8707304 CTCATCCTGCGGCTCGGGCAAGG - Intergenic
969753181 4:9128710-9128732 CTTCTTCTTCAGGTTGGGCAGGG - Intergenic
969813091 4:9664882-9664904 CTTCTTCTTCAGGTTGGGCAGGG - Intergenic
969930629 4:10627654-10627676 CTCCTCCTTCTGCTGCTGCAGGG + Intronic
969938229 4:10704581-10704603 CTGCTCCTCTAGGTTGGGCAGGG + Intergenic
970022347 4:11583355-11583377 GCCCTGCTTCAGCTTGCGCATGG + Intergenic
970512674 4:16796597-16796619 CTACCCCTTAAGCTTGGGCTTGG + Intronic
973365725 4:49207494-49207516 CTACTCCTTCAGTTTGGCCTTGG + Intergenic
973394872 4:49584959-49584981 CTACTCCTTCAGTTTGGCCTTGG - Intergenic
974177792 4:58345902-58345924 CTTCTCCTTCACCTTTGGCCAGG + Intergenic
974952590 4:68600906-68600928 CTTCTTCCTCAGGTTGGGCAGGG - Intronic
975283765 4:72593872-72593894 GTCCTGCTTCAGCTCGTGCACGG - Intergenic
976078028 4:81321384-81321406 CTCCTCCCTTGGCTTGGGGAGGG - Intergenic
978077629 4:104552837-104552859 CTCCTCCTTGAGCTTGGGCTAGG - Intergenic
978843309 4:113241628-113241650 CATCTCCTTCAAGTTGGGCATGG - Intronic
978848782 4:113308230-113308252 CTCCCCCCTTGGCTTGGGCAAGG + Intronic
980368788 4:131840313-131840335 CTCATCTTTCTGCCTGGGCAAGG - Intergenic
983654602 4:170070134-170070156 TTTCTCCTTCAGCTTGAGCACGG + Intronic
983936429 4:173506017-173506039 CTCCCCCTTCAGCCCGGGCGGGG - Intergenic
985461228 4:190108665-190108687 CTTCTTCTTCAGGTTGGGCAGGG + Intergenic
985493457 5:192173-192195 CACCACCTCCAGCTTGCGCAGGG - Exonic
985783850 5:1884062-1884084 CTCCGCTTTGAACTTGGGCAAGG - Intronic
985855831 5:2425938-2425960 CACCTCCTTGATCTTGAGCAAGG - Intergenic
985967133 5:3346301-3346323 CTCCTCCTTCCTCTTGGTGATGG + Intergenic
988035505 5:25823265-25823287 CTCCTCCTGCAGCCCTGGCATGG - Intergenic
990197383 5:53334012-53334034 CTCCTACTCCAGCTTGGGATAGG - Intergenic
990802662 5:59622634-59622656 GTCTTCCTTAAGATTGGGCATGG - Intronic
993378330 5:87176370-87176392 ATCCTCATTCTTCTTGGGCATGG + Intergenic
996110787 5:119564042-119564064 CTCCTGCTTCTGATTGGGAATGG + Intronic
997476516 5:134145629-134145651 CTCCTCCTTGCCCTTGGACAGGG - Intronic
997579447 5:135008118-135008140 CACCCTCTTCAGCTTGGCCACGG + Exonic
997844183 5:137271080-137271102 CTCCTCCTTCATCCTGGACATGG - Intronic
998769951 5:145531549-145531571 CTCCTCGCTCAGCTTAGGCCAGG + Intronic
998817535 5:146029303-146029325 CTACTCCCACTGCTTGGGCAGGG - Intronic
999395115 5:151222377-151222399 CTCCTCTTCCAGCTTGTGGAAGG + Intronic
999432211 5:151534350-151534372 CTCCTGGGTCACCTTGGGCAAGG - Intronic
999787737 5:154907338-154907360 CTTCTTATTCAACTTGGGCAAGG - Intronic
1000412214 5:160946029-160946051 ATCCTCCTTTAGCTTGGAGAAGG + Intergenic
1000600822 5:163272904-163272926 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1001191532 5:169637167-169637189 CTCCTCCCTCCCGTTGGGCAGGG - Intergenic
1005506414 6:26472730-26472752 ATCCTCATTCTTCTTGGGCATGG - Intronic
1005845015 6:29770262-29770284 CGCCTCCTTCAGCTTTGTAATGG - Intergenic
1006406403 6:33848266-33848288 GTCCACATTCAGCTTAGGCAGGG - Intergenic
1007172834 6:39876667-39876689 CTCCTCCACCAGCTGGGGCCAGG + Intronic
1007320142 6:41022265-41022287 CTCCTCCTTTAGATTAGGGAGGG + Intergenic
1007571703 6:42896293-42896315 CTTCTTCTTTAGGTTGGGCAGGG + Intergenic
1007824783 6:44592321-44592343 CCCCTCATTCAGCTGGAGCATGG + Intergenic
1008347970 6:50453036-50453058 CTCCTTCTTCTGTTTGGGGAAGG - Intergenic
1009870352 6:69445387-69445409 GCCCTGCTTCAGCTTGTGCAAGG + Intergenic
1011665141 6:89626233-89626255 TTCCTCTTTCAGCTTAGGCTAGG - Intronic
1012381438 6:98624268-98624290 AACCTCCTTCAGCTTGGGGGTGG + Intergenic
1012511348 6:100005460-100005482 CTCCTCCTTGAGTATGGGCTGGG + Intergenic
1012544839 6:100406479-100406501 CTCCTCTTTCAGCGTGCACAAGG - Intronic
1015097917 6:129439030-129439052 CTCATCCTTCAGTATTGGCAGGG + Intronic
1016132178 6:140488099-140488121 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1016826892 6:148396669-148396691 CTCTTCCTCCAGCTTGGAGAGGG - Intronic
1018160969 6:161041697-161041719 CTCCCACTACAGCTTGTGCAGGG + Intronic
1019076187 6:169389927-169389949 ATCCTCATTCTTCTTGGGCATGG - Intergenic
1020259249 7:6521454-6521476 CTCCACCACCAGCGTGGGCATGG + Exonic
1020561019 7:9728629-9728651 CTCCTCCTTCAGCTTCCCAAAGG + Intergenic
1023647200 7:42330326-42330348 TTTCTCTTTCAGCCTGGGCATGG - Intergenic
1023843155 7:44107841-44107863 CTCCTCCTTCTGCTTGGGGGTGG - Exonic
1023847690 7:44131938-44131960 CTACTCCTTGACCTTGGCCAAGG + Intergenic
1023908091 7:44536328-44536350 CTCCTCCCACAGCTTGGCCTGGG + Exonic
1024772030 7:52735022-52735044 CTTTTCCTTCATATTGGGCAAGG + Intergenic
1025261905 7:57425512-57425534 CTGCTCCTTCAGCATGAGGATGG - Intergenic
1026131235 7:67622540-67622562 CTTCTCCTTGAGCTTGGAGAAGG - Intergenic
1026482386 7:70790149-70790171 CTCCTCCTTCACCTTGACCTCGG - Exonic
1026942735 7:74297073-74297095 GTCCTCAGTCAGCTTGGGCCTGG + Intronic
1027188418 7:75984937-75984959 CTCCTCCTCCGGCGAGGGCAAGG + Exonic
1027774058 7:82443487-82443509 CTCCTTCCCCCGCTTGGGCAGGG - Exonic
1028148996 7:87350667-87350689 CTCATCCTTCTCCTTGGGGATGG - Intronic
1028621324 7:92832797-92832819 ACCCTCCTTCAGGGTGGGCAGGG + Intronic
1028708691 7:93882103-93882125 AACCTGCTTCAGGTTGGGCAAGG + Intronic
1029327499 7:99822955-99822977 CTCCTGCCCCAACTTGGGCAGGG - Intergenic
1033149333 7:138899572-138899594 CTCCTCATTCTGCTAGGGCAGGG + Intronic
1033849316 7:145475532-145475554 CTCTTCCTCCTGCTTGGCCATGG + Intergenic
1034200913 7:149282315-149282337 CTCCTCCTTCCGGCTGGGCCAGG - Exonic
1034413404 7:150952928-150952950 CTCCTCATTCTGCTTGGCCCCGG - Intronic
1035266984 7:157694470-157694492 GTCCGCCTTCAGCTTTGGCGAGG - Intronic
1036376388 8:8204041-8204063 CTTTTTCTTCAGGTTGGGCAGGG - Intergenic
1036853144 8:12219097-12219119 CTTTTTCTTCAGGTTGGGCAGGG + Intergenic
1036874519 8:12461619-12461641 CTTTTTCTTCAGGTTGGGCAGGG + Intergenic
1040078712 8:43266419-43266441 GCCCTGCTTCAGCTTGCGCATGG + Intergenic
1040088790 8:43373508-43373530 CTGCTCCTTCAGTTTGCCCATGG - Intergenic
1040316867 8:46266674-46266696 CTTCTTTTTCAGGTTGGGCAGGG + Intergenic
1040684678 8:49857393-49857415 CTCCTCTTACTTCTTGGGCAGGG - Intergenic
1041301386 8:56415381-56415403 GCCCTGCTTCAGCTTGCGCACGG - Intergenic
1041885242 8:62800786-62800808 GCCCTGCTTCAGCTTGCGCATGG - Intronic
1045385980 8:101671194-101671216 GCCCTGCTTCAGCTTGCGCAGGG - Intergenic
1045434241 8:102144562-102144584 CTCCTCCTTGAGCTTTGGTCTGG + Intergenic
1046019373 8:108645840-108645862 CTCCTCCTCCAGCATTGTCAGGG - Intronic
1046272205 8:111911608-111911630 ATCCACCTTCAGTGTGGGCAGGG + Intergenic
1048540265 8:135335550-135335572 ACCCTGCTTCAGCTTGCGCACGG - Intergenic
1048881936 8:138878254-138878276 CACCTCCTCCAGCGTGGGCAAGG - Exonic
1049252518 8:141596857-141596879 CTCTCCCTCCAGCTTGGGGAGGG + Intergenic
1049365052 8:142233046-142233068 CCCCTCCCTCAGCTTGGGGAGGG - Intronic
1049668570 8:143859559-143859581 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049668986 8:143861161-143861183 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669401 8:143862763-143862785 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669812 8:143864356-143864378 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049670228 8:143865964-143865986 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049876309 8:145023877-145023899 CTTCTTCTTCAGGTTGGGCAGGG + Intergenic
1049932076 9:467265-467287 CCCCTCCTTCAGCAAGGTCAAGG + Intergenic
1052718774 9:32149233-32149255 GCCCTGCTTCAGCTTGTGCACGG - Intergenic
1053423964 9:37998958-37998980 TTCCTCCAGCAGCCTGGGCAGGG - Intronic
1055305351 9:74923661-74923683 CTTCTCCTTCTCCTTCGGCAGGG - Intergenic
1056355496 9:85797608-85797630 CTTCACCTTCACCTAGGGCAGGG + Intergenic
1056789796 9:89618043-89618065 CACCTCCTTCTGCTTGGCCCTGG + Intergenic
1057074755 9:92132612-92132634 CACCTCCTTCAGCTCCTGCAGGG - Intergenic
1057379820 9:94557590-94557612 TTCCCACTTTAGCTTGGGCAGGG - Intergenic
1058448518 9:105074991-105075013 CTCTTCCTTTAGCTAGTGCAAGG + Intergenic
1058863618 9:109141466-109141488 CTCCTTCTTCATCTCTGGCAGGG + Exonic
1059136106 9:111807973-111807995 CTCCTCCTTCTTCTTCGACAGGG - Intergenic
1059349484 9:113654381-113654403 CACCACCTTGACCTTGGGCATGG + Intergenic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1060390690 9:123274186-123274208 GCCCACCTTCAGCTGGGGCAGGG - Intergenic
1061155057 9:128854814-128854836 CTTCTTCTTCAGGTTGGGCAGGG - Intronic
1062310755 9:135935185-135935207 GTCCTTCCTCAGGTTGGGCATGG - Intronic
1062474624 9:136720899-136720921 CTCCTGCCTCAGCCTGGGGAAGG + Intronic
1062525121 9:136975122-136975144 AGCCTCTTGCAGCTTGGGCAGGG - Intergenic
1062546232 9:137064881-137064903 CTGCTCCTTCAGCATGAGGATGG + Exonic
1062573320 9:137195308-137195330 CTCCTCCCTCAGCTTTCTCATGG - Intronic
1203527417 Un_GL000213v1:102513-102535 CTACTCCTTCAGTTTGGCCTTGG + Intergenic
1186458187 X:9727391-9727413 ATCCTCATTCTTCTTGGGCATGG + Intronic
1187602270 X:20845604-20845626 AACCTGCTTCAGCTTGTGCACGG - Intergenic
1188248631 X:27864057-27864079 CTTCTCCTCCAGGTAGGGCAGGG + Intergenic
1189917708 X:45873171-45873193 ATTCTCCTTCAGCTTTGTCAGGG + Intergenic
1191103745 X:56759692-56759714 CTCCTGCTTCAGCCTGTGGACGG - Intergenic
1191125905 X:56953641-56953663 GCCCTGCTTCAGCTTGTGCATGG + Intergenic
1191266233 X:58397054-58397076 ACCCTGCTTCAGCTTGAGCATGG + Intergenic
1191740483 X:64432343-64432365 CCCCTCTGTCAGTTTGGGCAAGG - Intergenic
1195163574 X:102196002-102196024 ATCCTCCTTTAGCTTGGAGAAGG + Intergenic
1195282452 X:103349009-103349031 CTCTTCCTTCACCCTGGGCCTGG + Intergenic
1195379064 X:104254333-104254355 CTCTTGCTTCAGCTCGAGCAGGG + Exonic
1196288873 X:113915501-113915523 ATCCTCATTCTTCTTGGGCATGG + Intergenic
1196570453 X:117260834-117260856 ACCCTGCTTCAGCTTGCGCACGG - Intergenic
1197648964 X:129044377-129044399 GTCCTGCTTCGGCTTGCGCAGGG - Intergenic
1197842485 X:130763576-130763598 TTCCAGCTTCAGCCTGGGCATGG + Intronic
1198312284 X:135434866-135434888 CTCTGCCCTCAGCTTGGTCACGG - Intergenic
1198594396 X:138220571-138220593 TTCCTCCTTCAGCATGGCTAGGG + Intergenic
1199513946 X:148654826-148654848 TTCCTTCTTCAGCTTGAGAAAGG - Intronic
1200260183 X:154611034-154611056 CTTCTTTTTCAGGTTGGGCAGGG + Intergenic
1200752669 Y:6961028-6961050 CTTCTTCTTCAGGTTGGGCAGGG + Intronic
1201320498 Y:12693502-12693524 ATCCTCATTCTTCTTGGGCACGG - Intergenic