ID: 1181473413

View in Genome Browser
Species Human (GRCh38)
Location 22:23154381-23154403
Sequence GTGGAAGTCCTGAGAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 404}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181473413_1181473420 2 Left 1181473413 22:23154381-23154403 CCCCCTTCTCTCAGGACTTCCAC 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1181473420 22:23154406-23154428 CCCCAGCAAAGCCCTGGAGATGG No data
1181473413_1181473418 -4 Left 1181473413 22:23154381-23154403 CCCCCTTCTCTCAGGACTTCCAC 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1181473418 22:23154400-23154422 CCACAGCCCCAGCAAAGCCCTGG 0: 1
1: 1
2: 4
3: 57
4: 531
1181473413_1181473427 26 Left 1181473413 22:23154381-23154403 CCCCCTTCTCTCAGGACTTCCAC 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1181473427 22:23154430-23154452 GGATAACAAATCTTGCCCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1181473413_1181473423 5 Left 1181473413 22:23154381-23154403 CCCCCTTCTCTCAGGACTTCCAC 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1181473423 22:23154409-23154431 CAGCAAAGCCCTGGAGATGGAGG 0: 1
1: 0
2: 6
3: 67
4: 580
1181473413_1181473426 25 Left 1181473413 22:23154381-23154403 CCCCCTTCTCTCAGGACTTCCAC 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1181473426 22:23154429-23154451 AGGATAACAAATCTTGCCCAAGG 0: 1
1: 0
2: 3
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181473413 Original CRISPR GTGGAAGTCCTGAGAGAAGG GGG (reversed) Intronic
900908803 1:5579621-5579643 GAGGAGGTGCTGAGCGAAGGGGG + Intergenic
901493173 1:9606966-9606988 GTGCAAGGCCAGAGAGCAGGAGG + Intronic
902710459 1:18235981-18236003 GTGGAAGGGATGAGAGAAGGGGG + Intronic
903886271 1:26542811-26542833 GGGGAGGACCTGAGAGAATGTGG - Intronic
905237940 1:36563087-36563109 GTGGGAGTCCTGAGAGAGGAAGG - Intergenic
905328982 1:37178927-37178949 GTGGAAGTGTGGAGAGAAAGGGG + Intergenic
905887692 1:41500519-41500541 AAGGAAGTCCTGAGAGGAGGCGG + Intergenic
906049158 1:42856472-42856494 GTGGCAATCCAGAGAGAGGGTGG - Intergenic
906241462 1:44244837-44244859 GTGGAGGTGCTGAGAGAACACGG - Intronic
906256683 1:44355740-44355762 GGGGGAGACCTGAGACAAGGAGG + Intergenic
907447672 1:54519368-54519390 GAGGAAGCCCTAAGTGAAGGTGG + Intergenic
907552279 1:55314558-55314580 GGAGAAGTGCTGAGTGAAGGTGG + Intergenic
907670722 1:56472831-56472853 ACAGAAGTCCTGAGAGCAGGAGG + Intergenic
907873679 1:58465913-58465935 GAAGCAGTCCTGAGAAAAGGTGG - Intronic
908343088 1:63202990-63203012 ATGGGAGTTGTGAGAGAAGGAGG - Intergenic
908819607 1:68070509-68070531 GGAGAAGTGTTGAGAGAAGGGGG - Intergenic
909439948 1:75685998-75686020 AGGGAAGTGCTGAGTGAAGGGGG + Intergenic
910271964 1:85405691-85405713 ATACAAGTCTTGAGAGAAGGTGG + Intronic
910864857 1:91779059-91779081 GTGAGAGTGCTGGGAGAAGGGGG + Intronic
910910796 1:92231897-92231919 GTTGAATGCCTGAGAGCAGGTGG + Intronic
911951792 1:104182482-104182504 GGGGAAGTGCTGAGTGAAGCAGG - Intergenic
912409522 1:109470581-109470603 GTAGAGGACCTGAGACAAGGGGG - Intronic
913223132 1:116675408-116675430 ATGGAAGATCTGAGAGAAGAGGG + Intergenic
913334118 1:117692870-117692892 GTGGAAGTTCAGAGAGCAGAGGG - Intergenic
914798856 1:150945054-150945076 GTGGAAGTCCCGAGTTGAGGAGG + Exonic
915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG + Intergenic
916271995 1:162952963-162952985 GTGGATATCCTGAGTGAATGAGG - Intergenic
916357138 1:163924345-163924367 GGAGAAGTGCTGAGAGAAGGGGG - Intergenic
917736094 1:177921585-177921607 CTGGCAGTGCTGAGAGAAGGGGG + Intergenic
918352439 1:183671071-183671093 GGAGAAGTGCTGAGTGAAGGAGG + Intronic
919208394 1:194448190-194448212 GGGGAAGCCTTGAGAGAAGTAGG - Intergenic
919340311 1:196298535-196298557 GTTGACGTCCTGAGAGAATGGGG - Intronic
919915061 1:202133997-202134019 GGGGCAGTCTGGAGAGAAGGAGG - Exonic
920544825 1:206807450-206807472 GTGAAGGCCCTGAGAGAAGAAGG - Intronic
920735008 1:208525807-208525829 CTGCAAGACCTGAAAGAAGGAGG + Intergenic
920825297 1:209419347-209419369 AAGGAAATCCAGAGAGAAGGTGG - Intergenic
922706985 1:227795234-227795256 GGGGAGCTCCTGAGGGAAGGCGG - Intergenic
922707013 1:227795296-227795318 GGGGAGCTCCTGAGGGAAGGAGG - Intergenic
923195579 1:231663396-231663418 GTGGAAATCATGAGAGAGGCTGG - Intronic
923236883 1:232042687-232042709 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
923894228 1:238251293-238251315 GTGGAAGTGAAGAGAGAAGAAGG - Intergenic
924077724 1:240358630-240358652 GGAGAAGTGCTGAGGGAAGGGGG + Intronic
1064581614 10:16798508-16798530 GGAGAAGTGCTGAGCGAAGGGGG - Intronic
1066464357 10:35640104-35640126 GTGGAAGTACTGCGAGTAGCCGG + Exonic
1066665011 10:37774122-37774144 GTGGCTGTCAGGAGAGAAGGAGG - Intergenic
1067497791 10:46774986-46775008 CTTGATGTCCAGAGAGAAGGAGG + Intergenic
1067596858 10:47565428-47565450 CTTGATGTCCAGAGAGAAGGAGG - Intergenic
1068733080 10:60381599-60381621 GTGGAAGAACTGAGAAAAAGAGG - Intronic
1069077213 10:64051319-64051341 GGAGAAGTGCTGAGTGAAGGTGG + Intergenic
1069112624 10:64465634-64465656 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1069514917 10:69069793-69069815 GTCCAAGTCCTGAGATAAGCGGG - Intergenic
1069549685 10:69354438-69354460 GGAGAAGTGCTGAGCGAAGGGGG + Intronic
1070748757 10:78951399-78951421 GTGGGAGTGCTGTGAGGAGGGGG - Intergenic
1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG + Intronic
1071342879 10:84664695-84664717 CTGGAAGTTCTGGGAGGAGGGGG + Intergenic
1073072447 10:100803281-100803303 GTGGAAGGGCAGAAAGAAGGAGG - Intronic
1073466038 10:103694975-103694997 AGGGAATTCCTGAGAGGAGGAGG + Intronic
1073561859 10:104503788-104503810 GTGAAATTCCTAAGAGAAGAGGG - Intergenic
1073630862 10:105147603-105147625 GTGCATGTCCTGAAAGAAGATGG - Exonic
1073915357 10:108396944-108396966 GGGCAAGGCATGAGAGAAGGAGG + Intergenic
1074725179 10:116300664-116300686 GTGGAAGTTCCCAGAGGAGGTGG + Intergenic
1074743895 10:116511762-116511784 GTGGAAATTCTGATAAAAGGGGG - Intergenic
1076101003 10:127778095-127778117 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1076238595 10:128884656-128884678 ATGGAGGTCCTGGGAGAGGGAGG - Intergenic
1076866257 10:133167831-133167853 GGGGAAGTCCTGAGCGGAGGGGG - Intronic
1077328154 11:1972506-1972528 GTGAGAGACCCGAGAGAAGGGGG - Intronic
1077636269 11:3843258-3843280 GTGGAGGACATGAGAGCAGGAGG + Intergenic
1079315341 11:19403423-19403445 GTGGAATTTCCCAGAGAAGGGGG + Intronic
1080581553 11:33648465-33648487 GTGGAAATCCATAGAAAAGGTGG + Intronic
1080737739 11:35033380-35033402 GTTTAAGTCCTCAGAGAATGAGG - Intergenic
1081148678 11:39598991-39599013 GTGGAAGGCTTTAGAGAAGATGG + Intergenic
1081447350 11:43143658-43143680 TTGGAATTCCTGGGAGGAGGAGG + Intergenic
1081702141 11:45158799-45158821 GTGTCTGTCCTTAGAGAAGGGGG - Intronic
1081846073 11:46241374-46241396 GTGAAGGTACTGAAAGAAGGAGG - Intergenic
1082829084 11:57602140-57602162 GTGGAAGATCTGAGAGACTGAGG - Exonic
1083313263 11:61796974-61796996 GAGGAACTGCTGAGAGAAGATGG + Exonic
1083442820 11:62688170-62688192 GTGGAGGACCGGGGAGAAGGGGG + Exonic
1084518937 11:69651104-69651126 GAGGCAGTCCTGAGAGAGAGAGG - Exonic
1085313550 11:75530198-75530220 GTGGAAGACCAGAGAGCAGGAGG - Intergenic
1086189281 11:84059398-84059420 GTGGAAGCCCTGAAGGAAGCAGG - Exonic
1087066075 11:94029240-94029262 GAAGAAGTCCTGGGACAAGGAGG + Intronic
1088527594 11:110773617-110773639 GTGGAAATCCTGGGAGGAAGAGG - Intergenic
1088586730 11:111366373-111366395 TTGGAAGACATGAGAGAAAGGGG + Intronic
1088709224 11:112491681-112491703 GTGTAACTCCTGAGAGGAGAAGG - Intergenic
1088747019 11:112812448-112812470 GAGGGAGTCCTGAGGGAATGTGG - Intergenic
1089369140 11:117941719-117941741 TTGGAAGTGCTGGGAGATGGTGG - Intergenic
1090244849 11:125208849-125208871 GTGGATGTGTTGAGTGAAGGAGG + Intronic
1202811133 11_KI270721v1_random:27686-27708 GTGAGAGACCCGAGAGAAGGGGG - Intergenic
1091668977 12:2438868-2438890 GTCTAACTCCTGAAAGAAGGTGG + Intronic
1091835125 12:3580305-3580327 GTGGAATTCCTGCCAGATGGGGG + Intronic
1092652863 12:10653526-10653548 GTGTAAAACCTGAGAAAAGGTGG + Intronic
1093018944 12:14185452-14185474 GTGGAAGGGAAGAGAGAAGGGGG + Intergenic
1093855412 12:24095805-24095827 GGAGAAGTGCTGAGTGAAGGAGG - Intergenic
1094514715 12:31119927-31119949 ATGGCAGTCCTAAGAGACGGGGG - Intergenic
1095908399 12:47401407-47401429 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1096104392 12:48988126-48988148 CAGCAAGTCCTGAGAGAATGAGG - Intergenic
1096603782 12:52749897-52749919 TTGAATGTCCTGGGAGAAGGAGG + Intergenic
1097158909 12:57031876-57031898 GGGAAAGGCCAGAGAGAAGGAGG - Intronic
1097159379 12:57035590-57035612 GGGAAAGGCCAGAGAGAAGGAGG - Intronic
1098167145 12:67710325-67710347 GTGGAAGCCCTGAGAAACGCAGG + Intergenic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1100086593 12:90918166-90918188 GAGGAAGCCCTGAGAAAAGAAGG - Intronic
1100120308 12:91362359-91362381 GTGTAATTCCTGGCAGAAGGTGG - Intergenic
1102558227 12:113742851-113742873 GTGGCAGTCATGAGATGAGGAGG + Intergenic
1102979717 12:117231847-117231869 ATGGAAGTCTTGAGCCAAGGGGG - Intronic
1106285963 13:28318251-28318273 GTGACAGGCCTGAGGGAAGGGGG + Intronic
1106432336 13:29693099-29693121 GTGGGAGTCCAGGAAGAAGGTGG - Intergenic
1107330005 13:39289238-39289260 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1108323314 13:49306783-49306805 GAGGAAGTGATGAGGGAAGGCGG + Intergenic
1110665915 13:78117023-78117045 GGAGAAGTGCTGAGCGAAGGGGG + Intergenic
1114427083 14:22632787-22632809 TAGGAAGTCATGAGAGAAGAGGG + Intergenic
1115742397 14:36402450-36402472 GTGGAAGTCCTCAGAGCATCAGG - Intergenic
1116595979 14:46845210-46845232 GGAGAATTGCTGAGAGAAGGGGG - Intronic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1117438727 14:55741365-55741387 GTGGGAGGCCTGGGGGAAGGAGG + Intergenic
1118122485 14:62860699-62860721 GGGTAGGTCCTGTGAGAAGGGGG - Intronic
1118228594 14:63927001-63927023 GTAAAGGTCCTGAAAGAAGGCGG + Intronic
1118964871 14:70571394-70571416 GGAGAAGTGCAGAGAGAAGGTGG - Intergenic
1119029912 14:71183855-71183877 AGGGAGGTCCTGAAAGAAGGTGG + Intergenic
1119073869 14:71616100-71616122 GTTGAAGTTCTGAAAGCAGGTGG + Intronic
1119688879 14:76654945-76654967 GCGAAAGTCCTGAGAGTGGGAGG - Intergenic
1120993129 14:90396544-90396566 CAGGAGGTCCTGAGAGTAGGGGG - Intronic
1121280004 14:92691313-92691335 GTGAGGGCCCTGAGAGAAGGTGG - Intergenic
1122227337 14:100287369-100287391 GTGGAAGGGCAGAGAGAAGGGGG - Intergenic
1122675539 14:103409943-103409965 ATGGAAGTCCTGGGTGAAAGTGG + Intronic
1123487171 15:20751749-20751771 GTTGGAGTCGTGGGAGAAGGTGG - Intergenic
1123543661 15:21320804-21320826 GTTGGAGTCGTGGGAGAAGGTGG - Intergenic
1124079219 15:26475641-26475663 GTGGAAGAGCTGAAAGCAGGAGG - Intergenic
1125270053 15:37928943-37928965 GGAGAAGTGCTGAGTGAAGGGGG + Intronic
1126112739 15:45185239-45185261 CCAGAAGGCCTGAGAGAAGGAGG + Intronic
1127271572 15:57406380-57406402 GTGGGGGTTCTAAGAGAAGGAGG + Intronic
1127514739 15:59681783-59681805 GAGGGATTCCTCAGAGAAGGAGG - Intronic
1127609099 15:60619961-60619983 GGGGAAGACGTCAGAGAAGGTGG - Intronic
1127836194 15:62793034-62793056 GGGGAAGCCCTGCAAGAAGGGGG - Intronic
1128361402 15:66964373-66964395 GTGGAGGACCTGTGTGAAGGGGG - Intergenic
1129018139 15:72487739-72487761 CTGGAAGCCCAGAGACAAGGAGG - Intronic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129195214 15:73960562-73960584 AGGGAAGTCCTGAGTGATGGAGG - Intergenic
1129354487 15:74980519-74980541 GTCCAGGTCCTCAGAGAAGGTGG - Intronic
1129718267 15:77864238-77864260 GGGGAAGGGCTGAGAGGAGGAGG + Intergenic
1130678834 15:85978642-85978664 ATGGAAGTTCTGAGCAAAGGTGG - Intergenic
1130744714 15:86638684-86638706 GAGGAACTTCTGAGAGAAAGAGG + Intronic
1130969748 15:88722739-88722761 GTGAAGGTCAAGAGAGAAGGCGG - Intergenic
1131107470 15:89744828-89744850 GTGGAAGGCCTGCCTGAAGGGGG - Intergenic
1131456863 15:92588424-92588446 GGGGAAGACCTGAGAGACAGTGG + Intergenic
1131510469 15:93047152-93047174 GTGGGAGGCCTGAGAGGAGGAGG + Intronic
1202951978 15_KI270727v1_random:47930-47952 GTTGGAGTCGTGGGAGAAGGTGG - Intergenic
1132648208 16:1008729-1008751 GTTGAGGTCCAGAGAGATGGGGG + Intergenic
1132675637 16:1120228-1120250 GGGGAAATCCTTAGAGCAGGTGG - Intergenic
1133981391 16:10635637-10635659 CTGGATGTCCTGATTGAAGGAGG + Intronic
1134755488 16:16663653-16663675 GAAGAAGTCCTGAGCGAAGAGGG - Intergenic
1134803735 16:17107867-17107889 GTGGCAGCCTTGAGGGAAGGAGG + Exonic
1134990578 16:18695517-18695539 GGAGAAGTCCTGAGCGAAGAGGG + Intergenic
1135147548 16:19975819-19975841 GGAGAAGTGCTGAGAAAAGGGGG + Intergenic
1136037916 16:27554534-27554556 GTGCAGATCCTGGGAGAAGGAGG - Intronic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1136791540 16:32972203-32972225 CTGGATGTCCAGACAGAAGGTGG - Intergenic
1136878274 16:33881729-33881751 CTGGATGTCCAGACAGAAGGTGG + Intergenic
1137783676 16:51119548-51119570 TTGGGAGGCCTGAGAGAAGAAGG - Intergenic
1138041457 16:53674272-53674294 TTTGAAGTCCCGAGACAAGGAGG - Intronic
1138308994 16:56007112-56007134 GAGTAAGTCCTGAGAGCAGGTGG + Intergenic
1139119997 16:64004074-64004096 TTGGAAATCCTCAGACAAGGAGG - Intergenic
1141737584 16:85864039-85864061 GGAGAAGTGCTGAGAGAAGGGGG - Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1203093749 16_KI270728v1_random:1233664-1233686 CTGGATGTCCAGACAGAAGGTGG - Intergenic
1142806428 17:2373375-2373397 GTGGAAGGCCTGCGAGGTGGTGG + Exonic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1143362969 17:6386618-6386640 GTGGAAGTCCTCAGAGAAGAAGG - Intergenic
1143590999 17:7885663-7885685 GTCCAAGTCCTGAGCGGAGGGGG - Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1144155513 17:12496666-12496688 GAGGAAGAGATGAGAGAAGGAGG - Intergenic
1145362143 17:22221285-22221307 GTAGAAGTCCAGAGAGATGCCGG - Intergenic
1146835158 17:36104824-36104846 GTGGGAGCCGAGAGAGAAGGGGG + Intronic
1147240310 17:39086445-39086467 TTGGAGGTCCTGAGAGCAGGGGG - Intronic
1147976134 17:44249198-44249220 GTGAAAGTGGTGAGAGATGGAGG - Exonic
1148956209 17:51355673-51355695 GTGGAAGTTCAGAGAGACAGAGG + Intergenic
1149124715 17:53214389-53214411 GTATAAATCCTGAGAGAAAGGGG + Intergenic
1150998163 17:70342922-70342944 GAAGAAGTACTGAGCGAAGGGGG + Intergenic
1151150349 17:72079774-72079796 GTGGAGGTGGGGAGAGAAGGCGG + Intergenic
1151573768 17:74940997-74941019 GTGAAAGTCCTACCAGAAGGCGG + Intronic
1152227717 17:79100404-79100426 GTGTAAGTCCTCAGAAAAGCAGG + Intronic
1152477613 17:80528371-80528393 TTGGAAGGCCTGAGAGAGGAGGG + Intergenic
1152755552 17:82085585-82085607 GTGGCTGCCCTGAGAGAAGGGGG - Exonic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1153630290 18:7062559-7062581 CTGGAAATCATGAGAGATGGTGG + Intronic
1154279748 18:12991739-12991761 GTGGAAGTCCCCAGACAAGAGGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155636671 18:27964189-27964211 GTGGTAGACCAGAGAGAGGGTGG + Intronic
1157132380 18:45018870-45018892 GTGGAAGTTCTGAGTAAGGGAGG + Intronic
1157193459 18:45600446-45600468 GTGGAGGGCCTGTGAGAAGAAGG - Intronic
1157275870 18:46310880-46310902 TTTGAAGTGCTGAGAGCAGGGGG + Intergenic
1157471082 18:47989479-47989501 GGGGAAGTACAGAGAGAGGGAGG + Intergenic
1158188820 18:54802235-54802257 GTAGAAATCCTTGGAGAAGGAGG + Intronic
1158486743 18:57874051-57874073 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1158986275 18:62820596-62820618 GGAGAAGTGCTGAGCGAAGGGGG - Intronic
1159337815 18:67092444-67092466 GAAGAAGTGCTGAGAGAAAGGGG - Intergenic
1160053618 18:75459436-75459458 GGAGAAGTGCAGAGAGAAGGGGG + Intergenic
1160460948 18:79037561-79037583 CTGGAAGGCCTGAGACATGGTGG - Intergenic
1160870832 19:1277109-1277131 ATGAGAGTCCTGAGGGAAGGAGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161452617 19:4354935-4354957 GTGGAAGTCCTGGGGAAGGGAGG - Exonic
1162223304 19:9198230-9198252 GAGGAAGTCCTTAGAGATTGGGG + Intergenic
1164925111 19:32124337-32124359 GGGGAAGTCCTTCGAGGAGGGGG + Intergenic
1165140605 19:33697783-33697805 ATTGGAGTCCTGAGAGAATGCGG + Intronic
1165749481 19:38251438-38251460 GATGAAGTCCTGAGACAGGGTGG + Exonic
1166631634 19:44412117-44412139 GGGGAAGGCCAGAGAGAAGCTGG - Intergenic
1166636542 19:44456504-44456526 GGGGAAGGCCAGAGAGAAGCTGG + Intergenic
1166662682 19:44657527-44657549 GTGGAAGCCCTGAGGAGAGGTGG + Intronic
1166917747 19:46207165-46207187 GTGGAGGTGCTGAGAGGATGGGG - Intergenic
1166936985 19:46339858-46339880 AGAGAAATCCTGAGAGAAGGAGG - Exonic
1167011089 19:46808338-46808360 GTGGAAATCCTGAGTGATAGTGG - Intergenic
1167787842 19:51650365-51650387 GTGGAAGTGGTGAGAAGAGGGGG + Intergenic
925040766 2:731800-731822 GTTGATGTCCTGAGAATAGGAGG + Intergenic
925053139 2:832810-832832 GAAGAAGTGCTGAGCGAAGGGGG - Intergenic
926068805 2:9867397-9867419 AGGGAAGCCCTGTGAGAAGGAGG - Intronic
926616203 2:14999094-14999116 GTGGCAGACCAGAAAGAAGGGGG + Intergenic
926760207 2:16271776-16271798 GTGGAAGTCCTGGGAAAAGCAGG - Intergenic
926947020 2:18199645-18199667 GTGCAAGTCCAGAGAGAGGTGGG + Intronic
927024254 2:19049328-19049350 TTGGAAGGCCTCAGAGGAGGGGG - Intergenic
928495077 2:31823159-31823181 GGCGAAGTCCTGAGATATGGGGG + Intergenic
928757730 2:34546416-34546438 GGAGAAGTGCTGAGCGAAGGGGG - Intergenic
929029062 2:37634002-37634024 GAAGAAGTGCAGAGAGAAGGAGG - Intergenic
929077181 2:38087664-38087686 GTGGAGGTCTTGAGGGAATGAGG - Intronic
930357881 2:50344945-50344967 GTGTGAGTCCTGAGGGACGGAGG - Intronic
931221443 2:60291777-60291799 GTGGAAGTTGTGAGACAGGGTGG - Intergenic
931638754 2:64363146-64363168 GTGGAAGTTCTGACAGTGGGAGG - Intergenic
933316739 2:80724512-80724534 TTAGAAGTCCTGAAAGATGGTGG + Intergenic
933651231 2:84852007-84852029 GTGGAGCTCCATAGAGAAGGGGG + Intronic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
934896800 2:98126754-98126776 TTGAAAGGCCTGAGAGAAAGAGG + Intronic
935242114 2:101187892-101187914 GGAGAAGTGCTGAGTGAAGGAGG - Intronic
935784932 2:106540498-106540520 GTGAAAGTCCTGAAAGCAGGGGG - Intergenic
935799728 2:106682254-106682276 GTGGTAGTCTTAAGAGATGGGGG + Intergenic
936386337 2:112032960-112032982 GGGGAAGTTCAGAGTGAAGGAGG + Intergenic
937038659 2:118803679-118803701 GTGGACTGCCTGAAAGAAGGAGG + Intergenic
937276415 2:120686911-120686933 GTGGAGGCCCTGGGAGGAGGGGG + Intergenic
937363150 2:121242870-121242892 GCGGGAGTCCTGAGAGTTGGGGG - Intronic
939961601 2:148570381-148570403 GAAGAAGTGCTGAGTGAAGGTGG + Intergenic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940426539 2:153537751-153537773 GGAGAAGTTCTGAGTGAAGGGGG - Intergenic
940479875 2:154214641-154214663 GAAGAAGTGCTGAGTGAAGGGGG - Intronic
940852893 2:158704980-158705002 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
942172927 2:173305026-173305048 AAGGAAGTCCTCAGAGGAGGAGG + Intergenic
943969494 2:194385557-194385579 TTGGAAGTCATGACAGAAGCTGG - Intergenic
944646063 2:201781957-201781979 GTGGAAGTCCCGACTGAAGTTGG - Intergenic
946808445 2:223496587-223496609 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
947381833 2:229552577-229552599 GTAGAAGTGCTGAGAAAAAGGGG - Intronic
947406449 2:229782294-229782316 GTAGAAGTGTTGGGAGAAGGGGG - Intronic
947858085 2:233338104-233338126 TTGGAAGGCAGGAGAGAAGGAGG + Intronic
948059297 2:235031670-235031692 GTGGAAGGCCTAAGAACAGGTGG - Intronic
948127661 2:235576666-235576688 GTGGAACTCTAGAGAGGAGGGGG + Intronic
948367765 2:237469595-237469617 GCAGAAGTGCTGAGCGAAGGCGG + Intergenic
1169322031 20:4640839-4640861 GTTAAAGTCCTGACAGGAGGTGG - Intergenic
1169501804 20:6167699-6167721 GTGCAAGTCCTCTGAGAAGTAGG - Intergenic
1171136699 20:22701265-22701287 GTGGAGGTCCTAAAGGAAGGTGG + Intergenic
1171159637 20:22909532-22909554 GTGCTAGTTGTGAGAGAAGGAGG + Intergenic
1171311207 20:24146222-24146244 GGGGAAAGCATGAGAGAAGGAGG + Intergenic
1171947405 20:31390486-31390508 CTGGCAGACCTGAGAGGAGGAGG + Intronic
1173582189 20:44155085-44155107 GTGGAAGTCTGGGGAGAAGGAGG - Intronic
1173846000 20:46189166-46189188 GGGGAACTCCAGAGAGAAGCTGG - Intronic
1174703034 20:52628300-52628322 GCAGAAATTCTGAGAGAAGGTGG - Intergenic
1175293439 20:57893361-57893383 GGGGAACTCCAGAGAGGAGGTGG - Intergenic
1175485015 20:59339567-59339589 GTGGAAGTTCTGGAAGAAGGTGG + Intergenic
1175903971 20:62370905-62370927 GTGGCAGCCCTGGGGGAAGGCGG - Intergenic
1177246398 21:18530833-18530855 GTGGAAGTGGTGAGAGAAAGTGG + Intergenic
1177312420 21:19414120-19414142 ATGGAAGGCGAGAGAGAAGGGGG - Intergenic
1177832996 21:26160147-26160169 GGGGAATTCCTGAGGGAAGCTGG - Intronic
1177873396 21:26600645-26600667 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1178682138 21:34681212-34681234 GGAGAAGTGCTGAGTGAAGGCGG + Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1182868082 22:33622311-33622333 GGAGAAGTGCTGAGTGAAGGGGG - Intronic
1183029366 22:35091852-35091874 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1184266441 22:43349409-43349431 CTGGGAGTCCTGAGAGAAGCAGG - Intergenic
949460634 3:4289268-4289290 TTGTAAGTGCTAAGAGAAGGAGG - Intronic
949885907 3:8693839-8693861 GAGGAAATCCTGAGAGCAAGGGG + Intronic
950966039 3:17146386-17146408 GAAGAAGTGCTGAGTGAAGGGGG - Intergenic
952631661 3:35477226-35477248 GAAGAAGTGCTGAGTGAAGGGGG - Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
953053354 3:39366524-39366546 GTGGAAATGATGAGAGTAGGAGG + Intergenic
953407858 3:42668484-42668506 GTGGAAATGCTGTGAGAATGAGG - Intergenic
953430753 3:42837842-42837864 ATGGAAGTCCAGGGAGATGGGGG - Intronic
953600804 3:44362406-44362428 TTTGAAGTCCTGAGAGCCGGGGG - Intronic
953930207 3:47002221-47002243 CTGGAAGTCTTCAAAGAAGGTGG - Exonic
954025849 3:47782296-47782318 GTGGAGGGCCTGAGGGAAAGCGG - Intergenic
954301210 3:49701735-49701757 GTGGGTGTTCTGAGTGAAGGAGG + Intronic
955191847 3:56769135-56769157 GTGCAAGTCCAAAGAGAATGAGG + Intronic
956227347 3:66974713-66974735 GGGGAAGTCTTGGGAAAAGGAGG + Intergenic
956309840 3:67866741-67866763 GTGGATTTCCTGAGATTAGGAGG + Intergenic
957867208 3:86040240-86040262 TTTGAAGACCTGAGAGAAGAAGG + Intronic
957875397 3:86139539-86139561 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
958119788 3:89270352-89270374 GTGGAAGTCCTGGCAGAAGGAGG - Intronic
958436182 3:94098626-94098648 GTAGGAGTCCTGAGACAATGAGG - Intronic
960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG + Exonic
961346693 3:126267882-126267904 TTAGAAGACCTGAGAGCAGGCGG - Intergenic
961654080 3:128432167-128432189 GTGGCAGTCGTGAGATCAGGTGG + Intergenic
963018625 3:140849921-140849943 GTGGAAGTCAGGACAGAAGCTGG - Intergenic
963187107 3:142430642-142430664 GTGGAAGTCATCAAAGAAGGTGG - Intronic
965965455 3:174483347-174483369 GGAGAAGTGCTGAGTGAAGGGGG + Intronic
966369716 3:179236641-179236663 GGAGAGGTCCTGGGAGAAGGAGG - Exonic
967229548 3:187324439-187324461 GTGGAAGTCCAGAGACCAGTCGG + Intergenic
968628535 4:1638594-1638616 GGGGAAGCCCTGGGGGAAGGTGG + Intronic
969075193 4:4572633-4572655 GTGGAAGGCATGATAGCAGGAGG - Intergenic
969663466 4:8543833-8543855 GAGGAAGTGCTGAGCAAAGGGGG - Intergenic
969947738 4:10801734-10801756 GGAGAAGTACTGAGCGAAGGTGG + Intergenic
970990069 4:22202721-22202743 GTGAATGTCCTGAAAGAAGCAGG - Intergenic
971591231 4:28472203-28472225 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
971945755 4:33274564-33274586 GAAGAAGTGCTGAGCGAAGGGGG + Intergenic
972575579 4:40348240-40348262 GAGGAAGTAATGGGAGAAGGAGG + Intronic
974312440 4:60230288-60230310 GGAGAAGTGCTGAGAGAAGGGGG + Intergenic
974880848 4:67755717-67755739 CTGGAAGTAGTGAGAGAAGCTGG - Intergenic
975381288 4:73703168-73703190 CTGGAAGTCCTGAGCAAAGGGGG + Intergenic
978395998 4:108280731-108280753 GTGGAGGCCCTGGCAGAAGGTGG + Intergenic
979093499 4:116517086-116517108 GTGGAAGTGATGAGAGAAATGGG + Intergenic
980751608 4:137097365-137097387 GAAGAAGTGCTGAGAGAAGGGGG - Intergenic
981713097 4:147728161-147728183 ATGGAAATCCAGACAGAAGGTGG - Intergenic
982372062 4:154644726-154644748 GTGGAAGCCCTAAGAGATAGAGG + Intronic
986626077 5:9725080-9725102 GGGGGACTCCTGAGAGAAGGGGG + Intergenic
987726988 5:21716075-21716097 GAAGAAGTGCTGAGGGAAGGGGG + Intergenic
987819203 5:22940410-22940432 GGGGAACTCCTGTGAAAAGGTGG - Intergenic
989228669 5:39061393-39061415 GTGGAAGGTCTGAGTGATGGTGG + Intronic
990322333 5:54642140-54642162 ATGAAAGGTCTGAGAGAAGGAGG + Intergenic
990381908 5:55227292-55227314 GAGGAGGTGCTGAGAGATGGCGG + Exonic
990448058 5:55911190-55911212 GTGGCAGTCAAGAGAGAATGAGG + Intronic
991185763 5:63805008-63805030 GTGGAAGCCCTGATAGCAGAGGG - Intergenic
992724808 5:79595499-79595521 GTGGAGCACCTGAGATAAGGAGG + Intergenic
992929900 5:81632631-81632653 ATACAAGGCCTGAGAGAAGGAGG - Intronic
993898417 5:93567514-93567536 GTAGAAGTCTTGAGCAAAGGTGG + Intergenic
994973171 5:106769498-106769520 CTGGGGGTTCTGAGAGAAGGAGG + Intergenic
994995699 5:107059699-107059721 GTGGAATTCCTGGGTGAAAGGGG - Intergenic
995353901 5:111215082-111215104 GGAGAAGTGCTGAGTGAAGGTGG - Intergenic
996179432 5:120400542-120400564 GAGGAAGTGCAGAGAAAAGGTGG - Intergenic
996739750 5:126788047-126788069 GTGGAAGAAAGGAGAGAAGGTGG + Intronic
997226377 5:132212414-132212436 ACGGAAGACATGAGAGAAGGAGG + Intronic
997402775 5:133615231-133615253 TGGGAAGTCATGTGAGAAGGTGG + Intergenic
997435373 5:133870299-133870321 GTGGAAGACCTGAGTCAGGGTGG + Intergenic
998372122 5:141668691-141668713 GTAGGAGACCTGGGAGAAGGGGG + Intronic
998627310 5:143860352-143860374 GTGGCACTGCTGAGAGAAAGAGG + Intergenic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003486659 6:6586062-6586084 GTAGAATTCCTTAGAGAATGTGG + Intergenic
1004256494 6:14069240-14069262 GTGGAGATCCAGGGAGAAGGTGG - Intergenic
1006080009 6:31559617-31559639 GTTGAAGTCCTGAGAGGTGGAGG + Intergenic
1006311309 6:33262890-33262912 GTGGAAGGCTGGGGAGAAGGTGG + Intronic
1008558575 6:52700545-52700567 GGGTAAGCCCTGAGAGGAGGTGG + Intergenic
1009472307 6:64042847-64042869 GTGGAAGTCCTTAAAGATGGTGG - Intronic
1010712206 6:79188071-79188093 GTGAAAGTCATGAGAGAATCAGG - Intergenic
1010989148 6:82459735-82459757 GTGGAAGGCCAGTGAGAAGGTGG - Intergenic
1011311951 6:85989181-85989203 GTTGAAGTCCTCAGTGGAGGGGG + Intergenic
1011956535 6:93030900-93030922 GGAGAAGTTCTGAGTGAAGGGGG + Intergenic
1012563989 6:100622374-100622396 GTGGAAGTGCTGAGCAAAAGGGG - Intronic
1013681090 6:112527021-112527043 GCGGAAGTTCAGAGAGAGGGAGG - Intergenic
1014146641 6:118005581-118005603 GTGGAGGACAGGAGAGAAGGAGG - Intronic
1015572477 6:134635955-134635977 GTAGAGGGCCTGAGAGATGGTGG - Intergenic
1016311500 6:142738403-142738425 GTGACAATCCTGAGAGGAGGGGG - Intergenic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1017563411 6:155658155-155658177 GTGGCAGCCTTGATAGAAGGAGG + Intergenic
1017794966 6:157835703-157835725 GGAGAAGTACTGAGTGAAGGTGG - Intronic
1018788827 6:167130911-167130933 GTGGGGTCCCTGAGAGAAGGAGG - Intronic
1019374326 7:681117-681139 GGAGAAGTGCTGAGTGAAGGGGG - Intronic
1019804791 7:3115772-3115794 GAGGAGGTCCTGAGTGGAGGAGG - Intergenic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1020765056 7:12308953-12308975 GAGGGAGGCCTGAGAAAAGGAGG + Intergenic
1022188727 7:27996413-27996435 GTGGGAGGCCTGAGAGGATGTGG + Intronic
1023884004 7:44338633-44338655 ATTGAAGTGCTGAGTGAAGGTGG - Intergenic
1024041622 7:45560239-45560261 GTGGAAGTGCTGAGAGACTGGGG - Intergenic
1024731681 7:52260312-52260334 GTGCATGTCCTGAAAGAAGAGGG + Intergenic
1025093137 7:56079339-56079361 GTGCCAGTCCTGGGAGAAAGGGG - Intronic
1026653684 7:72237687-72237709 GGGGAACTCCTAAGAGAGGGAGG - Intronic
1026905480 7:74060556-74060578 GGGGAGGTGCTGAGAGGAGGAGG - Intronic
1027780421 7:82513666-82513688 TTGCAAGTCTTGGGAGAAGGGGG - Intergenic
1029617480 7:101668215-101668237 GTGGAAGCACTGGGACAAGGGGG - Intergenic
1029945637 7:104529824-104529846 GTGGAAGTCCAGAGTCAAAGAGG + Intronic
1030108864 7:106009553-106009575 GTGGAGTTCTTGAGAGCAGGTGG + Intronic
1030873264 7:114783280-114783302 GGAGAAGTTCTGAGTGAAGGGGG + Intergenic
1031661866 7:124435725-124435747 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1031962671 7:128003983-128004005 GTGGAAATGCTGAGATTAGGAGG - Intronic
1032202358 7:129831102-129831124 GAGGAAGCCCTTTGAGAAGGGGG - Exonic
1033257452 7:139814537-139814559 GTGGAAGGCCTCATACAAGGTGG + Intronic
1033654461 7:143363070-143363092 GGGGATGCCCTGAGAGAAAGTGG + Intergenic
1034539069 7:151744528-151744550 TTGGAAGTCCAGAGATAGGGTGG - Intronic
1034816123 7:154173555-154173577 GTGGAAGCACACAGAGAAGGGGG - Intronic
1034984041 7:155496580-155496602 GTGGTAGCCATGAGGGAAGGAGG - Intronic
1035350691 7:158244143-158244165 ATGGAAGTCCTGGGGGAAGGAGG - Intronic
1035772000 8:2155229-2155251 GAAGAAGTGCTGAGTGAAGGGGG - Intronic
1036690600 8:10942451-10942473 CAGGAAGTCCTGGGAGCAGGAGG - Intronic
1037580052 8:20239746-20239768 GTGGCAGAGCTGAGAGAGGGGGG + Intergenic
1038150333 8:24937680-24937702 GGGGAAGTGCTGAGAAAAAGGGG - Intergenic
1039567711 8:38563480-38563502 GTGGAAGGCATGCAAGAAGGAGG - Intergenic
1040426239 8:47289551-47289573 GTGGAAAACCTGACAGAATGGGG - Intronic
1040797432 8:51301139-51301161 GTGGAAGTGCTGAGCAAAAGGGG + Intergenic
1040867307 8:52061325-52061347 GTGGGACTGTTGAGAGAAGGTGG - Intergenic
1040956807 8:52988111-52988133 GTGGAGGTCCTGAAAGATTGTGG - Intergenic
1041366789 8:57114836-57114858 GTGGAAGTCATGCGGGAAAGTGG + Intergenic
1042013923 8:64285420-64285442 GGGGGAGTGCTGAGTGAAGGAGG + Intergenic
1043006392 8:74824304-74824326 GTGGAAGCCCAGAGAAAAAGGGG + Intergenic
1043274768 8:78379228-78379250 GTGAAGGTCCTGAAAAAAGGAGG + Intergenic
1044181351 8:89199082-89199104 CTGGAAGTCCTCAGAGATGCAGG - Intergenic
1045337096 8:101215593-101215615 TTACAAGTCCTGGGAGAAGGGGG - Intergenic
1045570126 8:103360216-103360238 CTGGAAGTGGTGAGAGAAGCTGG - Intergenic
1045841192 8:106583704-106583726 GTGGAACTCCTGAAAGTAGTTGG + Intronic
1046578862 8:116067210-116067232 TTGGAAGTCATGACAGAAGCTGG + Intergenic
1046886104 8:119368855-119368877 GTTGAGGACCTGAAAGAAGGTGG - Intergenic
1047515096 8:125547056-125547078 GTGGCAGTCCAGAGTGGAGGAGG + Intergenic
1047941054 8:129827563-129827585 GCAGAAGTGCAGAGAGAAGGTGG + Intergenic
1048532808 8:135265689-135265711 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1048541006 8:135342096-135342118 GAGACAGTCCTGAGAGCAGGGGG - Intergenic
1048590741 8:135818479-135818501 CTGGAGGTCCTGAGAGATGAGGG + Intergenic
1048940546 8:139396808-139396830 GAAGAAGTGCTGAGTGAAGGGGG - Intergenic
1049837735 8:144749260-144749282 GTGGATGTCTTGAGACCAGGAGG + Intronic
1052178856 9:25500855-25500877 GGAGAAGTGCAGAGAGAAGGAGG - Intergenic
1052826718 9:33181724-33181746 GCAGAAGTCCTGGGAGAAGAAGG - Intergenic
1053509288 9:38673498-38673520 GTGAATGTGCTGAGAGAAGGAGG + Intergenic
1054874263 9:70078903-70078925 GTAGAATTCCTAAGGGAAGGAGG - Intronic
1055275517 9:74611542-74611564 GGGGAAATCATGAGAGTAGGCGG + Intronic
1057614797 9:96579650-96579672 GTGGAGGTACAGGGAGAAGGCGG + Intronic
1059516421 9:114900195-114900217 GAGGAAGTGCTGAGGGAAGCTGG + Intronic
1059569965 9:115424243-115424265 GAAGAAGTGCTGAGTGAAGGTGG + Intergenic
1060032999 9:120231767-120231789 ATGGTAGTCCTGAGAGAGGGTGG + Intergenic
1060069563 9:120534277-120534299 GTGGAAGTCCAGAGGCAAGAAGG - Intronic
1060399278 9:123338744-123338766 GTTGAGGCCCTGAGAGAAGCAGG + Intergenic
1060571284 9:124642801-124642823 GTGGAAGCCATGAGAGAGGGAGG + Intronic
1060866951 9:127008068-127008090 GTGGATGTTGTGAGAGAGGGAGG + Intronic
1061884965 9:133586791-133586813 GTGGCAGTCCTGAGAAAGGCAGG - Intergenic
1062063483 9:134512818-134512840 GTGGAAGAACTGAGAGGAGGGGG - Intergenic
1185644349 X:1606585-1606607 TTGGAATTCCAGAGGGAAGGAGG + Intergenic
1186350103 X:8731830-8731852 CTGGAAGTGCTGGAAGAAGGCGG + Exonic
1188484548 X:30668852-30668874 ATGGAAGTCCTGAGAGAGGATGG + Intronic
1188839992 X:35005374-35005396 GTGGGAGAGATGAGAGAAGGAGG - Intergenic
1189281975 X:39825370-39825392 GCGGAAGGGGTGAGAGAAGGAGG + Intergenic
1190097628 X:47494437-47494459 GGAGAAGTGCTGAGCGAAGGGGG + Intergenic
1190887186 X:54540355-54540377 GTGGAAGCCGGGAGAGAGGGAGG + Intronic
1194144243 X:90244032-90244054 GAAGAAGTGCTGAGTGAAGGGGG + Intergenic
1194359997 X:92938172-92938194 GGAGAAGTGCTGAGCGAAGGGGG + Intergenic
1194633152 X:96311535-96311557 GAGGAAGTGCTGAGTGAAGGGGG + Intergenic
1197797897 X:130317776-130317798 AGGGAAATCCTGAGAAAAGGAGG - Intergenic
1198017425 X:132625327-132625349 GGAGAAGTGCTGAGTGAAGGGGG - Intergenic
1198258681 X:134947255-134947277 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1199360904 X:146917250-146917272 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1199574399 X:149299513-149299535 GAAGAAGTGCTGAGTGAAGGGGG - Intergenic
1200490007 Y:3813337-3813359 GAAGAAGTGCTGAGTGAAGGGGG + Intergenic
1200803811 Y:7411538-7411560 GGAGAAGTGCTGAGTGAAGGGGG + Intergenic
1201015704 Y:9599372-9599394 GGAGAAGTCCTGAGCAAAGGGGG - Intergenic
1201464958 Y:14270261-14270283 TGGGAAGTCCTGAGACATGGTGG - Intergenic
1201559393 Y:15300245-15300267 TGGGATTTCCTGAGAGAAGGGGG + Intergenic
1201585485 Y:15555892-15555914 GTGCAATTCCTGAGAGAGGAAGG + Intergenic
1202593630 Y:26513347-26513369 GTGGAAGAACTCACAGAAGGAGG + Intergenic