ID: 1181478243

View in Genome Browser
Species Human (GRCh38)
Location 22:23181365-23181387
Sequence GGCAGCCGCGTCGGGGGAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181478230_1181478243 -1 Left 1181478230 22:23181343-23181365 CCGGGACCGCCCGCAGGCCCGGG 0: 1
1: 0
2: 3
3: 24
4: 294
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1181478228_1181478243 0 Left 1181478228 22:23181342-23181364 CCCGGGACCGCCCGCAGGCCCGG 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1181478226_1181478243 5 Left 1181478226 22:23181337-23181359 CCAGGCCCGGGACCGCCCGCAGG 0: 1
1: 2
2: 6
3: 21
4: 297
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1181478234_1181478243 -10 Left 1181478234 22:23181352-23181374 CCCGCAGGCCCGGGGCAGCCGCG 0: 1
1: 0
2: 2
3: 25
4: 419
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1181478233_1181478243 -7 Left 1181478233 22:23181349-23181371 CCGCCCGCAGGCCCGGGGCAGCC 0: 1
1: 0
2: 2
3: 57
4: 469
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1181478225_1181478243 15 Left 1181478225 22:23181327-23181349 CCGGGTAAGGCCAGGCCCGGGAC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181478243 Original CRISPR GGCAGCCGCGTCGGGGGAAC GGG Exonic
900977277 1:6025590-6025612 GGCAGCCGCCTTGAGGGGACAGG - Intronic
902332366 1:15736812-15736834 GGGAGCCGTGGCGGGGGCACTGG + Exonic
905212700 1:36385637-36385659 GGCGGCCGCGGCGGTGGAATCGG - Intronic
905912040 1:41662020-41662042 GGGAGCCGCGTCGGTGGGAGAGG - Intronic
922335646 1:224616550-224616572 GGAAGCCGCGTCTGGGGCGCAGG + Exonic
1066464213 10:35639472-35639494 GGCGGCGGCGGCGGGGGACCCGG - Exonic
1067576132 10:47409751-47409773 GGCAGCCGAGTCGAGGTGACAGG + Intergenic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1070800700 10:79243118-79243140 GCCAGCCGCGGCGGGGGGAGGGG - Intronic
1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG + Intronic
1072151686 10:92689704-92689726 GACAGCCGCGGCGGGGCACCAGG + Intergenic
1077219317 11:1408398-1408420 GGCAGCAGCCACGGGAGAACTGG + Intronic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1081720619 11:45285953-45285975 GGCAGCTGCAGAGGGGGAACTGG - Intronic
1083658316 11:64240957-64240979 GGCAGCGGCGTCGCGGGGGCGGG + Intergenic
1090856904 11:130617764-130617786 GGCAGAGGAGTCGAGGGAACAGG + Intergenic
1094121498 12:26979456-26979478 GGCAGCTGAGTCGGGGAACCTGG - Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1095450461 12:42325862-42325884 GGCAGCCGAGTCTGGGGAGGGGG + Intronic
1096777659 12:53973927-53973949 GGTAGCAGCGGCCGGGGAACGGG + Intronic
1098279170 12:68845940-68845962 GGCAGCGGGGTCGGGGGAGGTGG - Exonic
1103377559 12:120469076-120469098 GGCAGCACCGTAGGGGGAAGCGG - Intronic
1106739347 13:32622924-32622946 GGCAGCTGAGTCAGGGGAATGGG + Intronic
1116849355 14:49893084-49893106 GGCAGCGGCGGCGGCAGAACTGG + Exonic
1116945181 14:50830250-50830272 GGCCGGGGCGTCGGGGGTACTGG + Intronic
1119649912 14:76376247-76376269 GGCGGCCGCGGCGGGGGAGAGGG - Intronic
1120074610 14:80141293-80141315 GGCAGCATGGTCGGGGGAATAGG - Intergenic
1120190666 14:81436560-81436582 GGGAGCCGGGGCGGGGGGACTGG + Intergenic
1121309691 14:92929114-92929136 GGCAGCGGCGGCGGGGGGAGAGG + Intronic
1125494722 15:40181565-40181587 GGTAGCAGAGTCGGGGGAAATGG - Intronic
1125999255 15:44194571-44194593 GGCCGCCCCGTCGGGGGCGCAGG - Intronic
1127293756 15:57592140-57592162 GGCGGCCGGGATGGGGGAACGGG - Intronic
1128752456 15:70159222-70159244 GGCTGCTGGGTGGGGGGAACAGG - Intergenic
1130253582 15:82315741-82315763 GGCAGCGGTGGCGGGGAAACTGG - Intergenic
1130531108 15:84748483-84748505 GGCTGCCGCGGCGGGGGATTGGG - Intergenic
1131056702 15:89379177-89379199 GGCAGCCGCGACGGAGGGTCCGG - Intergenic
1131493684 15:92883441-92883463 GGCAGCCTCGTCGCCGGGACTGG + Intronic
1132466700 16:80863-80885 GGCAGGTGCGTCGTAGGAACAGG + Intronic
1132851563 16:2027127-2027149 GGCGGCCTCGGCGGGGGAACCGG - Exonic
1133156573 16:3880478-3880500 GGCGGCGGCGGCGGCGGAACGGG - Exonic
1136715663 16:32279309-32279331 GGCGGGTGCGTCGTGGGAACTGG + Intergenic
1136752246 16:32650458-32650480 GGCGGGTGCGTCGTGGGAACTGG - Intergenic
1136799859 16:33060294-33060316 AGCAGGCGCGTGGTGGGAACTGG + Intergenic
1136822345 16:33330004-33330026 GGCGGGTGCGTCGTGGGAACTGG + Intergenic
1136828908 16:33386543-33386565 GGCGGGTGCGTCGTGGGAACTGG + Intergenic
1136833974 16:33485325-33485347 GGCGGGTGCGTCGTGGGAACTGG + Intergenic
1139576118 16:67843169-67843191 GGCCGCCGCGTCGGAGTTACAGG + Exonic
1140016465 16:71191748-71191770 GGCAGCTGGGTCGGTGGAGCTGG - Intronic
1141489099 16:84359815-84359837 GGCAACTGAGTCTGGGGAACAGG + Intergenic
1142179780 16:88662792-88662814 GGCAGCCGTCGCGGGGGAACGGG + Intronic
1203010942 16_KI270728v1_random:239195-239217 GGCGGGTGCGTCGTGGGAACTGG - Intergenic
1203054391 16_KI270728v1_random:910442-910464 GGCGGGTGCGTCGTGGGAACTGG - Intergenic
1145765742 17:27457067-27457089 GGCGGGTGCGTCGTGGGAACTGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146438971 17:32877093-32877115 GGCAGCCGCGGCGGGAGGAGCGG - Exonic
1146656940 17:34639976-34639998 GGCAGCAGCCTAGGGGGCACAGG + Intergenic
1146933798 17:36797439-36797461 GGCAGCTGTGTCCTGGGAACAGG - Intergenic
1148214749 17:45828391-45828413 GGCAACCCCGTGGGGGGAGCCGG - Intronic
1149423174 17:56530405-56530427 GGCTGCCGTATCTGGGGAACTGG - Intergenic
1151334504 17:73432014-73432036 GGCACCCGGGTTGGGGGAGCTGG + Intronic
1151540286 17:74761308-74761330 GGCAGCGGTGTCGGGGGAGGAGG + Intronic
1152616836 17:81341775-81341797 GGCAGCCGCGGCGGGACACCCGG - Intergenic
1155876919 18:31100883-31100905 GGGAGCAGCGTCTGGGGAATTGG - Intronic
1159511325 18:69401052-69401074 GGCCGCCGCGGACGGGGAACGGG - Exonic
1160863637 19:1248212-1248234 GGCGCCCGCGTGGGGGGGACGGG - Intergenic
1163796986 19:19343468-19343490 GGCAGTCGGGTAGGGGGACCTGG - Intronic
1164512582 19:28909696-28909718 GCCAGCCGAGCCGAGGGAACAGG - Intergenic
1165065720 19:33226809-33226831 GGGGGCCGCGTCGGGGCCACCGG + Intergenic
926088949 2:10037740-10037762 GGCACAGGCGTCGGGGGAAGAGG - Intergenic
929127324 2:38533760-38533782 GGAAGCCGAGTCAGGGGAACAGG + Intergenic
934736301 2:96691525-96691547 GCCAGCAGCGGCGGCGGAACCGG - Intergenic
934978549 2:98822671-98822693 GGCCTCTGCGTCGAGGGAACCGG + Exonic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1174611659 20:51802279-51802301 GGCGCCCGCGGCGGGGGAGCTGG - Exonic
1175321715 20:58092913-58092935 GGCAGCCTGCTCGGGTGAACAGG + Intergenic
1175606112 20:60313674-60313696 GGCAGCCTCTTAGGTGGAACAGG + Intergenic
1178584750 21:33862608-33862630 GGCAGCCGCGTCTGGGAAGATGG + Intronic
1179054325 21:37916900-37916922 GGCAGCCCCGGCGCGGGAGCCGG + Intergenic
1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG + Exonic
1182620737 22:31617151-31617173 GGCAGCTGGCTCGGGGGAAATGG - Intronic
1184820842 22:46908230-46908252 GGCAGTGGAGTCGGGGGAAGGGG + Intronic
951078558 3:18425302-18425324 ATCCGCCGCGTCCGGGGAACGGG + Intronic
955368720 3:58332895-58332917 GACAGCGGCGGCGGTGGAACCGG + Exonic
959079574 3:101785721-101785743 GGGAGCCGAGTCTGGGGATCTGG + Intronic
968585312 4:1413658-1413680 GGCACCCGCGTCTGGGGTAACGG - Intergenic
976297253 4:83484877-83484899 CGCGGCGGCGTCGGGGGAGCGGG + Intronic
978328931 4:107590269-107590291 GGCAGCAGGGAAGGGGGAACAGG + Intronic
979920492 4:126490279-126490301 GGCAGGCGGGTAGGGGGGACGGG - Intergenic
985988350 5:3535878-3535900 GGCGGCCGCCTGCGGGGAACAGG + Intergenic
988482073 5:31639315-31639337 GGCAGGCGCGGCGGCGGCACCGG + Intergenic
997235878 5:132271677-132271699 GGCACCCGAGACTGGGGAACGGG - Intronic
997585098 5:135039306-135039328 GGTAGCAGCCTCGGGGGCACGGG - Intronic
998133163 5:139661150-139661172 GGCAGCCGCGGCGGGGAGGCTGG - Intronic
998850465 5:146346101-146346123 GGAAGCGCCGTCGGGGGAACAGG - Intergenic
1001535847 5:172497337-172497359 GGCAGCTGAGTCCGGGGAAGGGG + Intergenic
1001688741 5:173616405-173616427 GGCGGCGGCGGCGGGGGAACTGG - Exonic
1006491587 6:34392539-34392561 GGCAGCGGCGGCGCGGGACCTGG - Exonic
1006521200 6:34572211-34572233 CGCAGCCCCGTCGTGGGAAAAGG - Intergenic
1006860739 6:37170226-37170248 GGCAGCGGCGGCGGCGGGACCGG + Exonic
1007393814 6:41565845-41565867 GGCAGCAGCGGCGGGGCCACAGG + Exonic
1007661507 6:43489609-43489631 GGCAGCAGTGTTTGGGGAACAGG + Intronic
1019739292 7:2664864-2664886 GGCAGGGGCATTGGGGGAACAGG + Intergenic
1026672676 7:72403359-72403381 GGCAGCCGCATCGGGGGTCCAGG + Exonic
1026890282 7:73977662-73977684 AGCAGCCAGGTGGGGGGAACAGG - Intergenic
1026951128 7:74347589-74347611 GGGAGCCGCGTGGGGGTAAGGGG - Intronic
1033157737 7:138971259-138971281 GACAGCAGCGTGGGGGGATCAGG - Intronic
1035677086 8:1463520-1463542 GGCAGGAGCGTCCTGGGAACAGG - Intergenic
1039907806 8:41798859-41798881 GGCGGCCTCGTCAGGGGACCTGG - Intronic
1044242461 8:89902725-89902747 GGCAGCCTCGCCGGGGGAGGCGG + Exonic
1062016882 9:134295547-134295569 GGCAGCGTCCTCTGGGGAACGGG + Intergenic
1062528034 9:136986065-136986087 GGCAGCCGCTTGGGAGGACCCGG - Intronic
1062587394 9:137255443-137255465 TGCGGCGGCGCCGGGGGAACGGG + Exonic
1193715838 X:84934380-84934402 GGCGGGGGCGTCGGGGGAATCGG - Intergenic
1195605633 X:106802936-106802958 TGCAGCGGCGTCGGGGCTACGGG + Exonic
1201290943 Y:12420803-12420825 GGCAGCTGGGTTGGGGGAAGAGG - Intergenic